ID: 1130881420

View in Genome Browser
Species Human (GRCh38)
Location 15:88059131-88059153
Sequence CAGCAGCAATGGCAAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 308}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130881416_1130881420 -2 Left 1130881416 15:88059110-88059132 CCTGGAAAAGAGAAAATCTTCCA 0: 1
1: 0
2: 2
3: 33
4: 401
Right 1130881420 15:88059131-88059153 CAGCAGCAATGGCAAGCAGAGGG 0: 1
1: 0
2: 4
3: 27
4: 308
1130881413_1130881420 25 Left 1130881413 15:88059083-88059105 CCTCTGGCTACAGCCATTTAGAG 0: 1
1: 0
2: 0
3: 9
4: 155
Right 1130881420 15:88059131-88059153 CAGCAGCAATGGCAAGCAGAGGG 0: 1
1: 0
2: 4
3: 27
4: 308
1130881415_1130881420 12 Left 1130881415 15:88059096-88059118 CCATTTAGAGCTCTCCTGGAAAA 0: 1
1: 0
2: 1
3: 18
4: 179
Right 1130881420 15:88059131-88059153 CAGCAGCAATGGCAAGCAGAGGG 0: 1
1: 0
2: 4
3: 27
4: 308
1130881412_1130881420 26 Left 1130881412 15:88059082-88059104 CCCTCTGGCTACAGCCATTTAGA 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1130881420 15:88059131-88059153 CAGCAGCAATGGCAAGCAGAGGG 0: 1
1: 0
2: 4
3: 27
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130881420 Original CRISPR CAGCAGCAATGGCAAGCAGA GGG Intronic
900434199 1:2620244-2620266 CAGCAGCAAGGGGAGTCAGAAGG + Intronic
901087769 1:6622138-6622160 CAGCAGCTGAGGCAGGCAGAGGG - Exonic
901812636 1:11776581-11776603 CAGCAGCAGCGCCCAGCAGAGGG - Exonic
902226614 1:15000222-15000244 CAGCAGCCATGGGATGCAGGCGG + Intronic
902726668 1:18340735-18340757 CAACACCAGAGGCAAGCAGAGGG - Intronic
902925854 1:19695258-19695280 CTGAAGCAATGGGCAGCAGAGGG - Intronic
903650655 1:24919597-24919619 CAGCAGAAAGGCCAAGAAGAGGG - Intronic
904906730 1:33902831-33902853 CAGGAGGAAAGGCAATCAGAGGG - Intronic
904911485 1:33937513-33937535 CAGCAACATTGGCAGGAAGAGGG - Intronic
905874086 1:41421377-41421399 CAGCAGGCCTGGGAAGCAGACGG + Intergenic
908708350 1:66986797-66986819 CAGTAGCTTTAGCAAGCAGATGG + Intronic
909093643 1:71258966-71258988 CATTGCCAATGGCAAGCAGAAGG + Intergenic
909409050 1:75328082-75328104 CAGCAGGGATGGAAAGCAGCTGG - Intronic
910675212 1:89809309-89809331 CAGCAGGAAGGGAAAGCTGAAGG - Intronic
910866007 1:91788642-91788664 GATAAGCAATGGCAAGGAGAAGG + Intronic
911397904 1:97335190-97335212 CTGCAGCCATGGAAAGAAGAGGG - Intronic
912254607 1:108046245-108046267 CAGCAGCAAGGCAAAGCACATGG - Intergenic
915583470 1:156830258-156830280 CAGCAGCTCTGTCAAACAGAGGG + Intronic
919461988 1:197888678-197888700 CAGCAACAATAGAAACCAGAAGG - Intergenic
919964966 1:202513728-202513750 CTGAAGCAAAGGCAAGCAAAAGG + Intronic
920987302 1:210902547-210902569 CAGCAACAGTGGGAAACAGACGG - Intronic
921116710 1:212098862-212098884 CAGAAGCTGTGGCAGGCAGATGG - Intronic
921796500 1:219350881-219350903 CAGCAGCAAATGCCAGAAGATGG - Intergenic
923521633 1:234739435-234739457 AAGCAGCAAGGGGCAGCAGAAGG - Intergenic
924897475 1:248357334-248357356 CAGCAGCAACTGCAGGCAGCAGG - Intergenic
1063869593 10:10403293-10403315 CAGGAGGAATGGAAAGAAGAGGG + Intergenic
1064477641 10:15707906-15707928 TAGTAGCAATGGAAAGCAAATGG + Intronic
1065804747 10:29384156-29384178 CAGCAGCTAAGGCACGCTGATGG - Intergenic
1066311877 10:34205549-34205571 CAGATGCAATGGCAAGCAGAGGG + Intronic
1066991135 10:42515101-42515123 CAGGAGCAAGGGCAAAGAGAGGG - Intergenic
1068052577 10:51969014-51969036 CAGCAGCAATGACAATAAAATGG + Intronic
1068120531 10:52779134-52779156 GAGCAGCAAAGGAAGGCAGAGGG + Intergenic
1072609115 10:97004867-97004889 CAGCGGCACAGGCTAGCAGATGG + Intronic
1073369440 10:102973955-102973977 CAGCAGCAATTGCATGGAGATGG - Intronic
1074360208 10:112819765-112819787 CAGCAGCCATAGCATGGAGAAGG - Intergenic
1074576782 10:114677132-114677154 CAGCAGCAGTGGCAAACAAGTGG - Intronic
1075268290 10:121025439-121025461 GAGCAGCACTGGCCAGCAGCAGG + Intergenic
1076141360 10:128080949-128080971 CAGGCACAAGGGCAAGCAGATGG - Intronic
1076151903 10:128169200-128169222 TACCATCAAGGGCAAGCAGAGGG - Intergenic
1076291745 10:129350762-129350784 AAACAGCAGCGGCAAGCAGACGG + Intergenic
1076500091 10:130930236-130930258 CACCAGCTATGGCAGGAAGAAGG - Intergenic
1077520525 11:3030649-3030671 CAGCAGAAACGACAAACAGATGG + Intronic
1077871002 11:6261001-6261023 AAGGAGCAATGTTAAGCAGAAGG + Intronic
1078642468 11:13109290-13109312 CCTCAGCAATGGGAAGCAGCAGG + Intergenic
1078909187 11:15715180-15715202 CAGCAGCAGTCGGAAGCAGGTGG - Intergenic
1081539857 11:44025873-44025895 CAGAAACTATGGAAAGCAGAAGG - Intergenic
1083161896 11:60859451-60859473 CACCTCCAAAGGCAAGCAGAGGG + Intergenic
1087456243 11:98389948-98389970 CAGCAGTAGTGTCAAGCTGAAGG - Intergenic
1087999113 11:104853031-104853053 CAGCAGCTCTGGCAAGTTGATGG + Intergenic
1090700416 11:129290030-129290052 GAGCAGCAAGGGCCAGCAAAAGG + Intergenic
1090976670 11:131685290-131685312 CAGCATCCATGGGAAGCAGCTGG + Intronic
1091339321 11:134798126-134798148 GAGCAACAATGGCAAACGGAGGG + Intergenic
1091983513 12:4886564-4886586 CAGCAGAAATGGCAAACAGCAGG + Intergenic
1095554299 12:43482590-43482612 CAGCCCCAGTGGGAAGCAGAAGG - Intronic
1096401191 12:51307878-51307900 GAGCTGCAGTGGAAAGCAGAAGG - Intronic
1096900798 12:54879335-54879357 CAGTAATAATGGAAAGCAGAAGG + Intergenic
1098881336 12:75920373-75920395 TTGGAGCAGTGGCAAGCAGATGG + Intergenic
1100375251 12:94008991-94009013 CAGCAGCCCTGGCAATCAGTGGG + Intergenic
1100767757 12:97886600-97886622 CTGCAGAAATGGTAAGCATATGG + Intergenic
1101410813 12:104466497-104466519 CAGCCCCAAAGGCAAGAAGATGG + Intronic
1106179970 13:27362136-27362158 GAACAGCGATGGCCAGCAGATGG + Intergenic
1106900508 13:34350407-34350429 CAGATGAAATGGCAACCAGAAGG - Intergenic
1108111066 13:47073401-47073423 CAGCGGCAGTGGCCAGCAGCAGG - Intergenic
1108578488 13:51809243-51809265 CAGCAGCTATGGAAAACAGTAGG - Intergenic
1109162472 13:58992636-58992658 CAACAGAAATGGTAACCAGAGGG + Intergenic
1109314484 13:60734132-60734154 GAGCAGGAATGGTCAGCAGAGGG + Intergenic
1110533764 13:76627472-76627494 CAGCAGGAGTGGCAAGAAGATGG + Intergenic
1110884831 13:80619624-80619646 CTGAGGCAATGGCAAGAAGAGGG - Intergenic
1111224331 13:85249577-85249599 CTGCAGCAGTGCCAAGCAGGGGG + Intergenic
1111558779 13:89915803-89915825 ATGCATCAATGGCAAGGAGAGGG + Intergenic
1112298669 13:98210935-98210957 CAGCAGCAATGGAAATCAAAAGG - Intronic
1113818207 13:113190355-113190377 CAGAAGCAAAGGAAACCAGATGG + Intronic
1113886392 13:113661487-113661509 CAGCAACAAAAACAAGCAGAAGG + Intergenic
1114329059 14:21617838-21617860 CAGAAGCCATGGCAGGCAGGGGG - Intergenic
1115474307 14:33799486-33799508 CAGCAGCATTGGCAATCATCTGG - Intronic
1118162888 14:63308906-63308928 AAGCTGCAATGGCCACCAGAGGG - Intergenic
1118190573 14:63576536-63576558 CAGCAGCAAAGAGAAGCAAAAGG - Intergenic
1118404438 14:65409978-65410000 GAGCAGCAGAGGCAAGCAGTTGG + Intergenic
1118763418 14:68894445-68894467 CAGCAGCAAAGGGAAGGAAAGGG + Intronic
1119172513 14:72545858-72545880 CTGCAGAACTGGCAAGCTGAAGG - Intronic
1119411029 14:74430360-74430382 TATCAACAGTGGCAAGCAGATGG + Intergenic
1119625625 14:76172253-76172275 AAACGGCAATGGCAAGCTGAAGG - Intronic
1119709258 14:76809505-76809527 CTGCAGCAGTGGCGAGAAGAAGG - Exonic
1121059919 14:90897394-90897416 CAGCAGCAATAGCAAACTCATGG + Intronic
1121649954 14:95550582-95550604 CAGCAGCAAGGGCTAGCAGAGGG - Intergenic
1122762713 14:104041682-104041704 AACCAGCAATGGCAAGGAGGTGG + Intronic
1124902547 15:33837644-33837666 TGGCACCATTGGCAAGCAGATGG + Exonic
1125168307 15:36737202-36737224 CAGGAGCAAAGGCATGCAAAAGG - Intronic
1126200989 15:45985901-45985923 CAGCAGCAAAGAGAAGCAAAAGG - Intergenic
1126804909 15:52338248-52338270 CAGCAGCAGTGGCAAGAATAGGG + Intronic
1128691909 15:69731038-69731060 CTGGAGCAAAGGCCAGCAGAAGG - Intergenic
1128930628 15:71702130-71702152 CAGCAGGAAGAGCAAGCAGATGG - Intronic
1129318205 15:74758993-74759015 AGGCAGGAATGGCAAGCAGCGGG - Intergenic
1129540538 15:76343802-76343824 AAGCAGCCATGGCTAACAGAAGG - Intergenic
1130881420 15:88059131-88059153 CAGCAGCAATGGCAAGCAGAGGG + Intronic
1131174660 15:90202030-90202052 CAGCATCAAAGACAAGTAGATGG - Intronic
1131340813 15:91598964-91598986 GAGCAGCAAGGGCAGGTAGAGGG + Intergenic
1131571607 15:93543046-93543068 CAGCAGCACTGGAAACAAGAGGG - Intergenic
1131885895 15:96912377-96912399 CAGCAGATATGGCCAGCTGATGG + Intergenic
1132143307 15:99412199-99412221 CAGCAGCACTGGGAGGTAGATGG + Intergenic
1137342232 16:47619801-47619823 CAGCAGAAACTGCAAGCAGCTGG + Intronic
1137747841 16:50836279-50836301 CAGCAACAATGGGAAACAGCTGG + Intergenic
1137761062 16:50940674-50940696 CGGCGGCCATGGCAAGCAGCTGG + Intergenic
1140482021 16:75266968-75266990 CAGCATCCCTGGCAGGCAGAAGG - Intronic
1141454513 16:84131312-84131334 CAGCAGCCATGGCAACCTGCAGG + Exonic
1141662014 16:85446570-85446592 CAGCAGGAGTGGAGAGCAGAGGG + Intergenic
1141752333 16:85967201-85967223 CAGCTGCAATGGCAGGGAGCAGG + Intergenic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142772669 17:2110603-2110625 AAGCAGCAAAGGAAAGCAGACGG + Intronic
1143748498 17:9011317-9011339 CAGCAGCCATGAGAAGCTGAAGG - Intergenic
1145787201 17:27601895-27601917 TTCCAGCAATGGCCAGCAGATGG - Exonic
1147155761 17:38543855-38543877 AAGCAAACATGGCAAGCAGAGGG - Exonic
1147914545 17:43878698-43878720 CACCAGGCATGGCCAGCAGAGGG + Intronic
1148562343 17:48613279-48613301 CAGCAGCAAATGCGAGCAGGAGG - Exonic
1149308906 17:55375174-55375196 CAGAGGCAAAGGGAAGCAGATGG + Intergenic
1149574510 17:57702197-57702219 CAGCAGCCGGGTCAAGCAGATGG + Intergenic
1149627367 17:58089308-58089330 CGGCAGCGATGGCAAGCAGGCGG + Exonic
1149694320 17:58604524-58604546 CATCATCACTGACAAGCAGATGG + Intronic
1152012527 17:77727167-77727189 CAACAGAAAGGGCAAGGAGAAGG - Intergenic
1155371103 18:25101723-25101745 CAGAAGCAAAGGGAAGCAGCAGG + Intronic
1155872204 18:31042601-31042623 CAGCAGCAGATGCAGGCAGACGG + Exonic
1156156561 18:34309591-34309613 CAGCAGCAATAGCAGCAAGATGG - Intergenic
1156484047 18:37453620-37453642 CAGGAGCAATGGCAAGGAGGTGG + Intronic
1156782893 18:40873352-40873374 CAGGAATAATGGCAAGCAAAGGG + Intergenic
1158057232 18:53296150-53296172 CAGTAGCAATGCCAAGAATATGG - Intronic
1159161276 18:64646269-64646291 CCGCAACTGTGGCAAGCAGAGGG + Intergenic
1160397774 18:78584527-78584549 CAGAGGCCATGGCGAGCAGACGG + Intergenic
1160579832 18:79877410-79877432 CAGCAGCCAAGGGATGCAGAAGG + Intronic
1161547604 19:4891244-4891266 CAGCAGCAACGGCAGGTTGAAGG + Exonic
1162430601 19:10625897-10625919 CGGCAGCAGTGCCAGGCAGAGGG - Intronic
1165397861 19:35576991-35577013 GAGGTGCAAGGGCAAGCAGATGG + Intergenic
1166517950 19:43461365-43461387 CAGCAGCCACGGCCAACAGAAGG + Exonic
925855184 2:8122661-8122683 CAGCTGGAATGGGAGGCAGAGGG + Intergenic
926113615 2:10197461-10197483 AGGCAGCACTGGGAAGCAGAAGG + Intronic
926186505 2:10695038-10695060 CAGGAGCAAAGGCAAGAAGAGGG - Intergenic
926234091 2:11026414-11026436 CTGCAGCAGGGGCAGGCAGATGG - Intergenic
927945461 2:27132645-27132667 CAGCTGCACTGGCAAGAAAATGG - Exonic
928111328 2:28511526-28511548 CAGCAACAATGGAAGGCAAAAGG - Intronic
928436725 2:31259265-31259287 CAGCAGCAGTCGCATGAAGATGG - Intronic
928579294 2:32690606-32690628 CATAAGCAAAGGCAAGGAGACGG + Intronic
930286192 2:49431322-49431344 CATCATCACTGGCCAGCAGAAGG + Intergenic
930759893 2:55022529-55022551 AAGCAGCATTGGTGAGCAGAGGG - Intronic
931188145 2:59973645-59973667 CAGCAGAACTGGCAAGCGGAGGG + Intergenic
931701521 2:64913081-64913103 CAGCAGTAGTGGCAGGAAGAAGG + Intergenic
931776537 2:65545810-65545832 CAGCGTCAATGGGAACCAGAGGG - Intergenic
934613571 2:95757875-95757897 CAGCTGAAATTGCAAGCTGAGGG + Intergenic
934972476 2:98774537-98774559 CAAGAGCAAGGGCAAGCTGAGGG - Intergenic
935119193 2:100166423-100166445 CAGCAGTAATGGCAATTATATGG + Intergenic
935663678 2:105491074-105491096 CAGCACAAGTGCCAAGCAGAAGG - Intergenic
936083028 2:109447941-109447963 GAGCAGCAAATGCAGGCAGATGG + Intronic
937896097 2:126977662-126977684 CAGCAGCAAAGGAAGGCAGGAGG - Intergenic
939060137 2:137411862-137411884 CAGCAGCTCTGGTAAGGAGATGG + Exonic
940658443 2:156517580-156517602 CAGCAGTAATGGCCAGCTGTGGG - Intronic
940735259 2:157443972-157443994 CAGCAGCAATGGCAATTTGGCGG - Exonic
941210909 2:162637964-162637986 CAGAATCAATGGCAAGCCTATGG + Intronic
941276234 2:163494268-163494290 CAGAAACAAAGGCAAGCAGATGG - Intergenic
941899512 2:170664612-170664634 CAGCAGAAATGGCCAGAAGTAGG + Intergenic
942297943 2:174535335-174535357 CTGCTGCAATGGCAGGCAGTGGG + Intergenic
942546487 2:177069894-177069916 AAACAGCAATGCCAAGCACACGG - Intergenic
942571216 2:177316424-177316446 CAGAATCTCTGGCAAGCAGATGG + Intronic
945719174 2:213397367-213397389 AAGCAGCAATGAGAAGCAAAGGG - Intronic
945984805 2:216344965-216344987 AGGCAGTGATGGCAAGCAGAAGG + Intronic
946352334 2:219163428-219163450 CAGCAGCAAGGCCATGAAGATGG + Exonic
946489394 2:220133098-220133120 CAGTAGCAATGGAATGGAGAAGG - Intergenic
947396555 2:229693203-229693225 AAGGAGAAATGTCAAGCAGAAGG - Intronic
948170834 2:235900801-235900823 CAGCAGCCATGGCAGGAGGAAGG - Intronic
1169489101 20:6056280-6056302 AAGCAGCAGTGGCAAGAAGTTGG - Intergenic
1169732941 20:8806275-8806297 GGGAAGCAATGCCAAGCAGAAGG + Intronic
1170418969 20:16173563-16173585 CATAAGCAATAGCTAGCAGAGGG + Intergenic
1171382227 20:24742561-24742583 CAGCAGAACTGGGAAGCGGAAGG - Intergenic
1171878969 20:30602714-30602736 CAGCAGGAAGGGCAGCCAGAGGG + Intergenic
1172331653 20:34079915-34079937 CAGGAGCAATGGCCACCAGCAGG + Exonic
1173117244 20:40256841-40256863 CAGCAGAAATGGATAGCAGTAGG + Intergenic
1173600185 20:44289367-44289389 CAGTAGCAATGGCAGGCTCATGG - Intergenic
1175211183 20:57356976-57356998 CAGCAGCAATGGCAGGAGAAGGG - Intronic
1175603468 20:60293943-60293965 CAGCAGCAATTACCAGCAGTGGG - Intergenic
1176178103 20:63738050-63738072 CAGCAGCAGGGGTGAGCAGAGGG + Exonic
1176310465 21:5146364-5146386 CAGCTGCAAGGGGAAGCACAGGG + Exonic
1176966969 21:15222229-15222251 CTCCAGCTCTGGCAAGCAGAGGG + Intergenic
1179180735 21:39042708-39042730 CAGCAGTCATGACATGCAGAGGG + Intergenic
1179244206 21:39616362-39616384 CACAAGCAATGACAAGGAGACGG - Intronic
1179409540 21:41151977-41151999 CAGCAGAATTTGCAAGCATATGG + Intergenic
1179846590 21:44115671-44115693 CAGCTGCAAGGGGAAGCACAGGG - Exonic
1180033896 21:45232371-45232393 GAGCAGCAACAGCAAGCAAATGG - Intergenic
1180221500 21:46361635-46361657 CACCAGAAATGGCAAGTATAAGG - Intronic
1180523945 22:16236158-16236180 CAGCAGCAATGGAAAAAAGCTGG + Intergenic
1181093374 22:20489489-20489511 CAGCGGCAAAGTCAAACAGAAGG + Intronic
1182333042 22:29564409-29564431 CAGCATCATTGGCAAGAGGAAGG + Intronic
1182422939 22:30257411-30257433 CAGCAGGAGAGGGAAGCAGAGGG - Intergenic
1184630460 22:45774204-45774226 CAGCAGAAATGCCAAGTAGGAGG - Intronic
1185269184 22:49920837-49920859 CAGCAGCAGGGGCTGGCAGAAGG - Intronic
949407203 3:3726823-3726845 CAGCATCAATGACAAGATGACGG + Intronic
949564842 3:5235118-5235140 CAGCAGCAATGGCATCCTTAGGG - Intergenic
952231130 3:31432174-31432196 TGGCAGCAATGGCAGGCAGTTGG - Intergenic
953007079 3:38988538-38988560 CAGAAACAATGGCAGGGAGATGG - Intergenic
954446754 3:50550930-50550952 CAGCACCAAAGCCCAGCAGAGGG + Intergenic
954672556 3:52298700-52298722 CAGCAGGAGTGGGAGGCAGAGGG - Intergenic
954983511 3:54768269-54768291 CACCACCAATGAGAAGCAGATGG + Intronic
955855800 3:63272104-63272126 CGACAGCAATGGAAAGGAGATGG - Intronic
955956013 3:64291135-64291157 CAGCAGCAATGCAAAGCTTAGGG + Intronic
955969036 3:64418771-64418793 CAGCAGTGATGCCATGCAGAGGG - Intronic
956627716 3:71283084-71283106 CAGCACCAGTGGAAGGCAGATGG - Intronic
956871993 3:73427541-73427563 CACCTGCCATGGCATGCAGAAGG - Intronic
958456328 3:94336315-94336337 CAGCAGCAATGGAAAGCAGCTGG + Intergenic
961118614 3:124353659-124353681 CAGCTGCAAATGCAAGCAGAAGG + Intronic
961484446 3:127207262-127207284 GGGCAGCAGTGGGAAGCAGAGGG + Intergenic
962281060 3:134052229-134052251 TGGCAGCAATGGCCATCAGAAGG + Intergenic
962742173 3:138369786-138369808 CAGCTGCCTTGGCAAGCAGAGGG + Intronic
962826220 3:139102659-139102681 CAGCAGCAGTGGGAAAGAGAAGG + Intronic
965229970 3:166038105-166038127 GAGCAGCAGTGGCAAGTACATGG + Intergenic
965653526 3:170959390-170959412 CACCAGCCATGGAAAGGAGAAGG - Intergenic
966043058 3:175515748-175515770 CAGCAGCAATGAGAAGCTGTTGG - Intronic
966302350 3:178493761-178493783 CACCATCAATGGCAAGCACGTGG - Intronic
967363566 3:188659878-188659900 CAGTAACAATTACAAGCAGAGGG - Intronic
967438549 3:189479419-189479441 CAGGAGCAATGACAAGGAGATGG - Intergenic
967786611 3:193503695-193503717 CAGGAGCAAAGGCATACAGACGG - Intronic
967830192 3:193912152-193912174 AAGCAGAGATGGCAGGCAGAAGG - Intergenic
968980412 4:3845999-3846021 CAGCATCAGAGGCAAGCACAGGG - Intergenic
970324489 4:14909275-14909297 CAGCAGCAGGAGCAAACAGAGGG - Intergenic
970608005 4:17699758-17699780 CTGCAGAAATGGCAAACAAATGG + Intronic
972237817 4:37154370-37154392 AAGCAGCAACGGGAAGCAGGGGG + Intergenic
972393531 4:38635664-38635686 CACCAGCCATGCCAAGGAGAAGG - Intergenic
972632603 4:40855306-40855328 CAGCACCAATGCCCAGCACATGG + Intronic
972946490 4:44263106-44263128 CTGCAGCAACGGAAAGCATATGG + Intronic
973535766 4:51880505-51880527 CAGGAGCCACGGAAAGCAGAGGG - Intronic
974019019 4:56676721-56676743 CAGCAGCAGTGGGGAGGAGAGGG - Intronic
974928596 4:68333901-68333923 AACAAGCAATGGCAACCAGAAGG - Intronic
975696005 4:77013759-77013781 GAGAAGCAAAGGCATGCAGATGG + Intronic
977461904 4:97336815-97336837 TAGAAGCAGTGGCAAACAGAGGG + Intronic
977808100 4:101326551-101326573 AAGCTGAAATGGCAAGAAGATGG - Intronic
978203980 4:106057572-106057594 CAGTAGCATTGGAAAGCACAGGG - Intronic
981875421 4:149537774-149537796 CAGAATCAATGGTAGGCAGAAGG + Intergenic
982087288 4:151848618-151848640 CAATAGAAATGGAAAGCAGATGG + Intergenic
982138513 4:152295361-152295383 TAGAAGCAAGGGCCAGCAGAAGG + Intergenic
983861985 4:172718833-172718855 CAGCAGCAATAGGAAGATGATGG - Intronic
983980885 4:173995716-173995738 CAGTATCAATGGGAGGCAGATGG + Intergenic
984842587 4:184082012-184082034 CAACAGCAATGGGAAGCTGGTGG - Intergenic
985063815 4:186103117-186103139 GAGCAGCAATGGTAACAAGAGGG - Intergenic
987512792 5:18861891-18861913 CAGCAGCAATGACAAACCGTGGG + Intergenic
990600060 5:57349239-57349261 CAGCTGCAAGGGCAAACAAATGG - Intergenic
990657288 5:57971629-57971651 CAGCAGCAATGGAACACAGCTGG - Intergenic
991358401 5:65794127-65794149 CAGCAGCAAGTGCAAACTGATGG + Intronic
991502046 5:67286781-67286803 CAACAGAAATGGGAAGCAGGAGG + Intergenic
996205257 5:120726512-120726534 AAACAGAAATGGCATGCAGATGG + Intergenic
996552436 5:124744578-124744600 CAGCAGCACTGGCAAGAGGCAGG - Exonic
998216728 5:140243159-140243181 CAGCAGCAATGGCAGGAACACGG + Intronic
999383165 5:151136003-151136025 CAGAAGCAATGGCAGGAAGGAGG + Intronic
999673181 5:153975177-153975199 CAGCAGCAGTGACAAGGAGCTGG - Intergenic
1000368259 5:160510868-160510890 CAGCATCAGTGGGGAGCAGACGG - Intergenic
1001399765 5:171439482-171439504 CAGCACCAACGGCAAGAAGAGGG - Intronic
1002794816 6:463842-463864 CAGCAGCAAAGGCCTGCAGAGGG + Intergenic
1003199279 6:3943979-3944001 GAGCAGCAATTGCCAGCAAAGGG + Intergenic
1003425813 6:5997477-5997499 CAGCTGAAATGGCGAGGAGACGG - Intergenic
1004176068 6:13341272-13341294 CAGTAGAAATGTCAAGTAGATGG + Intergenic
1005247436 6:23904172-23904194 GAGCAACAATGGAAAGCAGAAGG + Intergenic
1005420681 6:25646053-25646075 CAGCAGCGAAGGCATTCAGAAGG + Intergenic
1005802383 6:29440398-29440420 CAGCAGCAGTGGGTAGCGGAGGG - Exonic
1006065423 6:31458127-31458149 CACCAGAAATGGTAAGCACATGG - Intergenic
1006079666 6:31558108-31558130 CAGCAGCAGCGAGAAGCAGAGGG + Exonic
1006283286 6:33073499-33073521 CAGCAGGAAAGCCAAGGAGAGGG + Exonic
1007028425 6:38602752-38602774 AGACAGAAATGGCAAGCAGAAGG + Intronic
1007171736 6:39868942-39868964 GAACAGCAAGGGCAAGGAGAAGG - Intronic
1007974302 6:46085293-46085315 CAGCAGCAATGGAAAAAAGCTGG - Intergenic
1009792904 6:68426375-68426397 CAGCATCTTAGGCAAGCAGATGG + Intergenic
1012828618 6:104179184-104179206 CCCCAGCAATGGCAAGGAGCAGG - Intergenic
1013723983 6:113069727-113069749 CAGCAAGAATGCCAAGCAAAAGG + Intergenic
1015787623 6:136933884-136933906 AAGCAGCAATGGGAAGCGGAAGG + Intergenic
1016026003 6:139287687-139287709 CACCAGGAAAGACAAGCAGAGGG + Intronic
1016873658 6:148843135-148843157 CAGGGGGAATGGGAAGCAGATGG + Intronic
1017567581 6:155704756-155704778 CAGCCGCTATGGAAAGCAGTCGG + Intergenic
1018061533 6:160093371-160093393 CAGAAGCAACGGCAACAAGAGGG - Intronic
1018804477 6:167248361-167248383 CAGCAGCAGAGGGAACCAGAGGG - Intergenic
1020224442 7:6269070-6269092 CAGGAGGAATGGCAGGAAGAAGG - Intronic
1020729415 7:11862888-11862910 CATCAGCAAAGACAAGCAGGTGG - Intergenic
1021148386 7:17118129-17118151 AAGAAGCAATAGCAAGCAAATGG - Intergenic
1021390599 7:20088083-20088105 AAGAAGCAATGGTAAGCAAAGGG - Intergenic
1022130860 7:27403130-27403152 CAGCAGCTAAGGCAGGCACATGG + Intergenic
1023085071 7:36562276-36562298 CAGCAGCAACAGCAAGCAGCTGG - Intronic
1023809122 7:43897803-43897825 CAGCAGCAATGGCATGTGGCTGG + Intronic
1024680447 7:51681517-51681539 CAAGAGCAAGGGCAAGAAGATGG + Intergenic
1026847507 7:73706132-73706154 CAGCCCCAGGGGCAAGCAGAGGG - Intronic
1027185397 7:75967999-75968021 CACCAGCAGGGGCCAGCAGATGG - Intronic
1027987260 7:85309118-85309140 CTGCAGCCATTGCAAACAGAGGG - Intergenic
1028116374 7:87002388-87002410 AAGTAGCAATGGCCACCAGAAGG - Intronic
1029409234 7:100398183-100398205 CACCAGGAAAGGCAGGCAGAGGG - Intronic
1031823423 7:126532940-126532962 CAGCAGAAAAGGTAAGTAGAAGG - Exonic
1032541084 7:132703798-132703820 CAGGAGCTTGGGCAAGCAGAGGG - Intronic
1035721936 8:1798855-1798877 AGGCAGCAATGGGAAGCAGGAGG - Intergenic
1035752144 8:2003234-2003256 CAGAAGCAAAGACAAGCAAAAGG - Exonic
1036962460 8:13259985-13260007 CAGGAGAAATGAAAAGCAGAAGG + Intronic
1038464752 8:27751209-27751231 CAGCAGCAATGGAAGGGATAAGG + Intronic
1039165147 8:34670644-34670666 CAGAAGGAATGGCAAGTACAAGG - Intergenic
1039387308 8:37147448-37147470 CGGCAGGACTGGCAAGCAAATGG - Intergenic
1042573184 8:70189562-70189584 CAGCAGCAACTTCAAGCACATGG + Intronic
1043004017 8:74795989-74796011 GAGCAGCAATGGAAAGCAGAGGG + Intronic
1043518572 8:81019684-81019706 CTGCAGGAGTGGCAAGCTGATGG + Intronic
1044088619 8:87971932-87971954 CAGCAGCAGTGGCAACCCGCTGG + Intergenic
1047303601 8:123635693-123635715 CAGTAACAATGGGAAGCAAAGGG - Intergenic
1048011948 8:130464833-130464855 CAACACCACTGGCAAACAGAGGG - Intergenic
1048402042 8:134081293-134081315 CAGGAGCAGTGGGAGGCAGATGG - Intergenic
1049351885 8:142169152-142169174 CAGCAGCAAAGGGAAGCACCGGG + Intergenic
1050478479 9:6065090-6065112 CAGCAGCACTGGCCAGGAGAAGG + Intergenic
1053020605 9:34691430-34691452 CAGGAGCCAAGGAAAGCAGAAGG - Intergenic
1056461003 9:86809918-86809940 CAGCTGGAATGGGAATCAGATGG + Intergenic
1059724124 9:116989413-116989435 CAGCCTCAATTGCAGGCAGATGG + Intronic
1061824830 9:133251770-133251792 AGGCAGCTGTGGCAAGCAGAGGG + Intronic
1061860098 9:133463658-133463680 CAGTAGCCATGGCAACCACAAGG - Intronic
1062166202 9:135108751-135108773 AAGCAGGAAGGGCACGCAGATGG - Intronic
1062233871 9:135498863-135498885 CAGGGACAGTGGCAAGCAGAGGG - Intronic
1062678082 9:137760063-137760085 CAGCAGCAACAGGAGGCAGAGGG + Intronic
1186198450 X:7132601-7132623 CAGAAGCAATGCCCAGGAGAGGG + Intronic
1186215216 X:7292761-7292783 CTGATGCAATTGCAAGCAGAGGG - Intronic
1188000906 X:24980457-24980479 TAGCAGCAAGAGCAAGGAGAGGG + Intronic
1189386272 X:40539404-40539426 TAGCAGCAATCGGAAGCAGCAGG - Intergenic
1189452400 X:41149504-41149526 CAACAGTTTTGGCAAGCAGAAGG - Intronic
1189946269 X:46182839-46182861 TAGCAGCAATGGAAGGCAGATGG - Intergenic
1190636144 X:52435869-52435891 CAGGAGCAATTGCATGCAGAAGG + Intergenic
1190711781 X:53076839-53076861 CAGCACAAAGGGGAAGCAGACGG - Exonic
1191147128 X:57178625-57178647 CAGCTTCAATGGGAATCAGAGGG + Intergenic
1191207811 X:57853058-57853080 CAGCAGCAATGGCAATGTGGTGG + Intergenic
1192588831 X:72342723-72342745 CAGCAGCTCTGCCAGGCAGAAGG + Intronic
1193276067 X:79589797-79589819 CAGCAGCAGTGGCAGTGAGATGG + Intergenic
1193317137 X:80077266-80077288 CAGCTGCAATGGCAGGGAGGTGG + Intergenic
1194267671 X:91775547-91775569 CAGCAACAATTGCAATCAGTAGG - Intergenic
1198091991 X:133340606-133340628 AAGCAGCAATGGCCAGCTCATGG - Intronic
1198823158 X:140670830-140670852 CAAAAGCAATGGCAGACAGAAGG - Intergenic
1199621176 X:149703055-149703077 CTAGAGCAATGACAAGCAGATGG + Intronic
1199740260 X:150728975-150728997 ATGGAACAATGGCAAGCAGAGGG + Intronic
1201349380 Y:13023195-13023217 GAGCAGCAATGGGCAGTAGATGG + Intergenic
1201361424 Y:13154432-13154454 CAGCAGCTGTGGCAGGCAGTGGG + Intergenic
1202300594 Y:23409555-23409577 CTGAAGCAAGGGCAAGCAAAAGG + Intergenic
1202570217 Y:26261043-26261065 CTGAAGCAAGGGCAAGCAAAAGG - Intergenic