ID: 1130884278

View in Genome Browser
Species Human (GRCh38)
Location 15:88080593-88080615
Sequence CAAAAGCCACCCTGGGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130884272_1130884278 15 Left 1130884272 15:88080555-88080577 CCCAAAGGCAACTGGCAATTTAC 0: 1
1: 0
2: 0
3: 15
4: 150
Right 1130884278 15:88080593-88080615 CAAAAGCCACCCTGGGCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 272
1130884273_1130884278 14 Left 1130884273 15:88080556-88080578 CCAAAGGCAACTGGCAATTTACA 0: 1
1: 0
2: 0
3: 23
4: 143
Right 1130884278 15:88080593-88080615 CAAAAGCCACCCTGGGCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130884278 Original CRISPR CAAAAGCCACCCTGGGCCTG AGG Intronic