ID: 1130884278

View in Genome Browser
Species Human (GRCh38)
Location 15:88080593-88080615
Sequence CAAAAGCCACCCTGGGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130884273_1130884278 14 Left 1130884273 15:88080556-88080578 CCAAAGGCAACTGGCAATTTACA 0: 1
1: 0
2: 0
3: 23
4: 143
Right 1130884278 15:88080593-88080615 CAAAAGCCACCCTGGGCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 272
1130884272_1130884278 15 Left 1130884272 15:88080555-88080577 CCCAAAGGCAACTGGCAATTTAC 0: 1
1: 0
2: 0
3: 15
4: 150
Right 1130884278 15:88080593-88080615 CAAAAGCCACCCTGGGCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130884278 Original CRISPR CAAAAGCCACCCTGGGCCTG AGG Intronic
900156642 1:1205861-1205883 CACCAGCCACACTGGGCCTCCGG + Intronic
900625539 1:3606949-3606971 CAACAGACACCCCAGGCCTGGGG + Intronic
900917798 1:5650775-5650797 CCAAGCCCACCCTAGGCCTGAGG + Intergenic
901625861 1:10624691-10624713 GAAAAGCTACCCTCTGCCTGTGG + Intronic
901751945 1:11415539-11415561 CAAGAGCCACACGTGGCCTGTGG + Intergenic
902546679 1:17194727-17194749 CACACCCCAGCCTGGGCCTGTGG - Intergenic
903901027 1:26645454-26645476 CAGAAGCCACCCTGAAGCTGGGG - Intergenic
905298727 1:36971670-36971692 CAGAAGCCTCCCTGGGATTGGGG - Intronic
907261693 1:53222921-53222943 CAATAGTCACCATGGGCCTTGGG + Intergenic
908111002 1:60897258-60897280 GGAAAGCCACCGTGAGCCTGGGG + Intronic
912680377 1:111725453-111725475 CTAAAGCCACTCTGGGCACGTGG - Exonic
912878682 1:113388685-113388707 CAAAAGCCTCCCTTGCCCTCTGG + Intergenic
914431706 1:147624782-147624804 CTACACCCACCCTGGGCCTGTGG + Exonic
919738418 1:200968097-200968119 AAGAAGCCACCCTGCTCCTGGGG + Intergenic
919977211 1:202620387-202620409 GAACAGCCACACTTGGCCTGGGG + Intronic
920310059 1:205043553-205043575 CAGCACCCACCCTGGGGCTGAGG - Intronic
920697141 1:208189518-208189540 AAAAAGCGAACCTGGGGCTGAGG + Intronic
922718391 1:227888303-227888325 GAACAGGCACCCTGGGCCTTAGG - Intergenic
924897457 1:248357217-248357239 CACAAGCAGCCCTGGGCGTGCGG - Intergenic
1063053439 10:2477452-2477474 CAAAAGCCAGCCGGGGCCACAGG - Intergenic
1064221425 10:13444089-13444111 GAAAAGCCACCCAGGAGCTGGGG - Intronic
1064488029 10:15817822-15817844 CAACCACCACCCTGGCCCTGTGG + Intronic
1065041750 10:21704964-21704986 CATATGCCACCCTGGGCCCAAGG - Intronic
1065363116 10:24908155-24908177 CCAAAGTCCCCCAGGGCCTGGGG + Intronic
1065673789 10:28152580-28152602 CAAAAGCCACACGTGGCCAGTGG - Intronic
1067034031 10:42899922-42899944 AAAAATCCAGCCTGGGCCCGTGG - Intergenic
1067788389 10:49269803-49269825 CCAGGGCCACCCTTGGCCTGTGG + Intergenic
1070477607 10:76845598-76845620 CTGGACCCACCCTGGGCCTGGGG + Intergenic
1071601044 10:86958895-86958917 AAAATGCCTCCCTGGGGCTGGGG - Intronic
1073027514 10:100498688-100498710 CAAAAGGTACCCTGACCCTGAGG - Exonic
1073497684 10:103908538-103908560 CAAAAGCCATATTGTGCCTGAGG + Intronic
1075312535 10:121426714-121426736 CAGAAGGCACCCTGGGCAGGAGG - Intergenic
1075517640 10:123121304-123121326 TCAAAGCCACCCTGGGCCACGGG + Intergenic
1075794489 10:125109408-125109430 ACAAAGTCACCTTGGGCCTGGGG - Intronic
1075917707 10:126183441-126183463 CAGTAGCCATCCTGGGACTGGGG - Intronic
1076736190 10:132460194-132460216 CAAAAGCGTCCCGGTGCCTGCGG + Intergenic
1076864398 10:133160015-133160037 CAGAGGCCACCCCGGGACTGCGG + Intergenic
1077359991 11:2136595-2136617 CAAAAACTCCCCTGGGTCTGCGG - Intronic
1077792016 11:5451263-5451285 CCAAAGCCATTCTGGGTCTGGGG - Intronic
1078803250 11:14668935-14668957 CACAAGCCTCCCTGCTCCTGGGG + Intronic
1079332544 11:19545684-19545706 TTAAAGCCACCCTGGGCCGCGGG - Intronic
1083637560 11:64128686-64128708 TCTAAGCCACACTGGGCCTGGGG - Intronic
1083661375 11:64252957-64252979 CCAACCCTACCCTGGGCCTGAGG - Intronic
1083736518 11:64684780-64684802 CACTAGCCATCCTGGGCCTTGGG + Intronic
1085011396 11:73143579-73143601 AAAAAACCTCCCTGGGCATGGGG - Intergenic
1085350010 11:75792309-75792331 CAAAAGCCAAACTGGGCCCGAGG + Intronic
1087066759 11:94034727-94034749 CAGATGCCACCCTGGGCCACTGG + Intronic
1087498093 11:98916619-98916641 CAATACTCACCATGGGCCTGGGG - Intergenic
1088592695 11:111416905-111416927 CAGGAGCCACGCTGGGCCTGCGG + Intronic
1089445911 11:118551993-118552015 CCAAAGTTACCCAGGGCCTGGGG + Intronic
1089643681 11:119864223-119864245 CTAAAGATTCCCTGGGCCTGGGG - Intergenic
1090659074 11:128869107-128869129 CACCAGCCACCCTGGTCCCGGGG + Intergenic
1090922689 11:131220706-131220728 CCACAGCCACCCTGAGCATGAGG - Intergenic
1091332857 11:134744257-134744279 CAAAAGCTACCCTTGGAGTGAGG - Intergenic
1091979090 12:4851057-4851079 CCACAGCCACCCTTGTCCTGGGG - Intronic
1092860037 12:12712371-12712393 CAAAAGCAAGCCTGGGCCCTGGG - Intergenic
1093631136 12:21411082-21411104 CAGTAGCCATCTTGGGCCTGAGG + Intronic
1093925581 12:24905098-24905120 CAAAAGAGAGCCTGGGGCTGCGG + Intronic
1095315836 12:40759795-40759817 AAAAAGCCACTGTGGGACTGGGG + Intronic
1095316666 12:40770294-40770316 TGAATGCAACCCTGGGCCTGAGG - Intronic
1096428276 12:51522444-51522466 CAGGATCCACCCTGGGCCTTAGG + Intergenic
1096772728 12:53946323-53946345 CAAAGGCCACCTTGGTGCTGTGG + Exonic
1097714775 12:62954720-62954742 CAGAAGCCCCCATGGGCCAGTGG - Intergenic
1100295087 12:93253784-93253806 CAAAAGCCACTCTGTTTCTGTGG - Intergenic
1100867046 12:98868212-98868234 CAGAACACACCCTGGGCCCGAGG + Intronic
1101157812 12:101944132-101944154 CAAAAGCCACTCTGAGGCTGTGG - Intronic
1103126555 12:118427902-118427924 CAAAACCCACCTTTGGACTGTGG + Intergenic
1103725387 12:122995178-122995200 CAAGGGCCATCTTGGGCCTGAGG - Intronic
1103889195 12:124225699-124225721 TTAAAGCCACCCTGGGCTGGCGG + Intronic
1103996587 12:124834139-124834161 CAACAGCCAGCAGGGGCCTGAGG + Intronic
1104092082 12:125525838-125525860 CAGATGCCACCCTGGGACTGTGG - Intronic
1104769041 12:131349023-131349045 CAAGAGCCTCCCTGAGCCCGGGG - Intergenic
1104784866 12:131443107-131443129 CCAAAGACGCCCTGGGCCCGCGG + Intergenic
1105507758 13:21024888-21024910 CCAAAGCCACGCATGGCCTGGGG + Intronic
1106214143 13:27679266-27679288 CAAAAGCCACAATGGCCGTGTGG + Intergenic
1106312070 13:28563219-28563241 CAAAGGCTACCCAGGGCCAGGGG + Intergenic
1107287768 13:38814973-38814995 CAAAACCTTCCCTGGGCCAGAGG - Intronic
1110067300 13:71124894-71124916 CAAAAGCCCCACTGGACCTAGGG + Intergenic
1110809110 13:79791845-79791867 CTGAAGCCAGCCTGGCCCTGGGG + Intergenic
1113583468 13:111446439-111446461 CAAACACCACACTGGGGCTGTGG + Intergenic
1113746299 13:112747229-112747251 CCGAATCCACCCTGGCCCTGAGG - Intronic
1116220877 14:42085650-42085672 CTGAACCCACCCTGGGCCAGAGG - Intergenic
1119395964 14:74326659-74326681 CAAAAGGCGCCCTGAGTCTGGGG + Intronic
1119825702 14:77655455-77655477 CAAGAGCTGCCCTGGGCTTGGGG + Intergenic
1120100106 14:80435133-80435155 CAACAGTCACCATGGGCCTTGGG + Intergenic
1123110288 14:105863978-105864000 CCAGGGCCACCCTGGGCCTCTGG - Intergenic
1126894054 15:53238911-53238933 CAAAAGCCACAAAGGGCCTTAGG - Intergenic
1128946495 15:71826320-71826342 ACAAAGCCACCTAGGGCCTGGGG - Exonic
1129696681 15:77744244-77744266 CAAAAGCCAGCCTGGCACAGTGG + Intronic
1130078097 15:80707641-80707663 CCAAAGCCATCCTGGGCCGAGGG + Intronic
1130884278 15:88080593-88080615 CAAAAGCCACCCTGGGCCTGAGG + Intronic
1132077964 15:98838756-98838778 CAAAAGGCACTCTGAGCATGAGG + Intronic
1132345933 15:101108863-101108885 CAGAAGCCAGCCTGCCCCTGGGG + Intergenic
1132371999 15:101305970-101305992 GAACACCCAGCCTGGGCCTGTGG + Intronic
1132674790 16:1117122-1117144 CCTCAGCCATCCTGGGCCTGTGG - Intergenic
1132903224 16:2269431-2269453 CAAAACCCGCCCTCGGCCGGGGG - Intergenic
1133641733 16:7723739-7723761 CCTAAGCCAACCTGGGCCTCTGG - Intergenic
1134042916 16:11081714-11081736 CAAAAGCCAACTTGGGCTTTTGG - Intronic
1135991095 16:27219265-27219287 CAGAGGCCTTCCTGGGCCTGGGG - Intronic
1136079818 16:27844707-27844729 CAAAAGCCATCCTTAGCTTGAGG + Intronic
1136639897 16:31554728-31554750 CCTAAGCCATCCTGGTCCTGGGG + Intergenic
1138349720 16:56340009-56340031 CCATGGCCATCCTGGGCCTGTGG - Intronic
1139891845 16:70258161-70258183 CGAAAGCCATCCAGGGCCTACGG - Exonic
1140112554 16:72016344-72016366 CAAAACCCACAGTGGGGCTGGGG + Intronic
1140654081 16:77122035-77122057 TCAAAGCCATCCTGGGCATGTGG + Intergenic
1141789895 16:86227289-86227311 CTGAAGCCTCCCTGGGCCTGGGG + Intergenic
1141842089 16:86579669-86579691 TAAAAGCCGCCCTGGACATGCGG - Exonic
1141986861 16:87585774-87585796 CAACACACACCCTGGGCCTGAGG - Intergenic
1142188998 16:88708759-88708781 CAAGAGTCACCCTGCACCTGGGG - Intronic
1142203595 16:88772396-88772418 CAACAGCCACGCTGGAGCTGAGG + Intronic
1142280390 16:89144909-89144931 CAGAAGCCCTGCTGGGCCTGTGG - Intronic
1142473749 17:178118-178140 CAGCAGCCACCTTGGACCTGAGG + Intronic
1142968707 17:3596936-3596958 CACAAGCACCCGTGGGCCTGGGG - Exonic
1143576915 17:7799075-7799097 CAGAAGCCACCCAGGGTCAGAGG - Intronic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1145910371 17:28538760-28538782 CTCAGCCCACCCTGGGCCTGGGG + Exonic
1145960938 17:28886216-28886238 CTGCTGCCACCCTGGGCCTGCGG + Intronic
1145993101 17:29090956-29090978 CCACAGGCACACTGGGCCTGAGG - Intronic
1146182247 17:30705902-30705924 CATAGGGCACCCTGGGCGTGCGG + Intergenic
1146261895 17:31427454-31427476 CAAAAGCCTACCTGGGACAGAGG - Intronic
1146375034 17:32288085-32288107 CAAAACCCAAGCTGTGCCTGGGG - Intronic
1147122789 17:38345484-38345506 CAAGAGACAGCCTGCGCCTGCGG - Intergenic
1147162197 17:38574828-38574850 CAAACTCCACCATGGGCTTGGGG + Intronic
1147545257 17:41396359-41396381 CTAAAGCAACCCTGAGCCAGAGG + Intronic
1149993338 17:61394769-61394791 GAAAAGGCACGGTGGGCCTGAGG + Intergenic
1151393131 17:73801371-73801393 CAGAAGCCACCCTCTGCCGGAGG + Intergenic
1152055320 17:78020838-78020860 CAATAGCCACACTTGGCCAGTGG + Intronic
1154173827 18:12068592-12068614 AAAAAGCCACCCTGCGGCCGGGG - Intergenic
1154337355 18:13476335-13476357 GAAAACCCAGCCTGGGCCGGTGG + Intronic
1155674582 18:28414566-28414588 CAAAAGCAAACCTGGGACAGAGG - Intergenic
1157056916 18:44240503-44240525 TCAAAGCCACCCTGGGCCGTGGG + Intergenic
1157620249 18:49013066-49013088 CAGAAGCCATCCTCGTCCTGGGG + Intergenic
1160679940 19:407952-407974 GACATGGCACCCTGGGCCTGGGG + Exonic
1160983868 19:1828555-1828577 AGAATGGCACCCTGGGCCTGGGG - Exonic
1161277157 19:3424959-3424981 CAAAACACACCCAGGCCCTGGGG - Intronic
1161420100 19:4171839-4171861 ACAACGCCACCCTGGTCCTGAGG + Exonic
1162380584 19:10329450-10329472 CCAAAGCCACCTGGGGCTTGGGG - Intronic
1162873081 19:13600397-13600419 AATGAGCCACCATGGGCCTGGGG + Intronic
1162976587 19:14209900-14209922 CATAGGGCACCCTGGGCGTGCGG - Intergenic
1163631339 19:18419435-18419457 AAAAAGCCACCCTGCGGCCGGGG + Exonic
1164761518 19:30731811-30731833 CAAGAGCAAGCCTGGGCCCGGGG - Intergenic
1165175369 19:33925625-33925647 GAAAAGCCCTCCTGGGGCTGGGG + Intergenic
1167509247 19:49887662-49887684 CATAGCCCAGCCTGGGCCTGAGG - Intronic
1167661905 19:50800180-50800202 CAAGAGCCACCCGTGGCCAGTGG + Intronic
1167942959 19:52962458-52962480 CACCGGCCACCCTGGGGCTGCGG + Intronic
1168126380 19:54285795-54285817 CCACACCCTCCCTGGGCCTGGGG - Intergenic
1168175515 19:54625069-54625091 CCACACCCTCCCTGGGCCTGGGG + Intronic
1168273859 19:55265549-55265571 CAGCACCCACCCTGGGCCAGGGG - Intronic
925045757 2:771870-771892 GAAAAGCCACCCTGACCCTGCGG - Intergenic
926051256 2:9746285-9746307 CAACAGCCATCCTGGAACTGAGG - Intergenic
927229270 2:20803787-20803809 CAAAAGTTACCCTAGGGCTGAGG - Intronic
931387708 2:61812004-61812026 CAGAACGTACCCTGGGCCTGGGG - Intergenic
932580639 2:72990864-72990886 CAATGGCCACCTTGGGGCTGGGG + Intronic
933639235 2:84741512-84741534 AAAAGGGCACCTTGGGCCTGGGG + Intronic
934692176 2:96370259-96370281 CAAGCACCACCCTGGGGCTGGGG + Intronic
934769014 2:96896133-96896155 CAAAGGCCACGCTGGGGGTGTGG - Intronic
935973704 2:108556788-108556810 CACAAGCAACACTGTGCCTGGGG - Intronic
937345852 2:121124886-121124908 CAGGAGACACCCTGGACCTGGGG - Intergenic
940100750 2:150035585-150035607 CCAAAGCCCCCCTGGGCCACAGG + Intergenic
941364272 2:164591441-164591463 ATTAAGGCACCCTGGGCCTGAGG - Intronic
943561115 2:189463613-189463635 AAAAAGCCACCCTGAGCCACAGG + Intronic
945659345 2:212666471-212666493 ACACAGACACCCTGGGCCTGTGG + Intergenic
946047173 2:216830853-216830875 CAAAAGCCATACTGGCCATGGGG + Intergenic
947392786 2:229656171-229656193 GAAAAGCCATCCTTTGCCTGTGG + Intronic
947597297 2:231421148-231421170 CAGGAGCCAGCCTGGGACTGGGG - Intergenic
948486571 2:238285102-238285124 CAAAAGCCAACATGAGCCTCTGG + Intronic
948556853 2:238817990-238818012 CCACAGCCCCACTGGGCCTGGGG - Intergenic
1168945133 20:1748114-1748136 CAAATGCCTCCCTGGGGCAGAGG + Intergenic
1170062809 20:12276863-12276885 CAGTAGTCACCATGGGCCTGGGG + Intergenic
1171342785 20:24443735-24443757 CAGCAGGCAGCCTGGGCCTGGGG + Intergenic
1172124148 20:32615143-32615165 CACAAACCAGCATGGGCCTGGGG + Intergenic
1173873802 20:46357391-46357413 CAAAACCCCCCCTGCACCTGCGG - Intronic
1176035687 20:63035409-63035431 CAGATGCAACCGTGGGCCTGGGG - Intergenic
1176046780 20:63097002-63097024 CAACAGGGGCCCTGGGCCTGGGG - Intergenic
1179573888 21:42294740-42294762 CAAAAGCCACTCTGGGCTGCTGG + Intronic
1179643921 21:42763981-42764003 CAAATGCCACCATGTGCCAGAGG + Intronic
1181317801 22:21982304-21982326 CAAAACCCAGCCAGGGCCTAGGG + Intronic
1181432025 22:22887702-22887724 CAAAGGGCAGCCTGGGTCTGTGG - Intronic
1181988607 22:26819832-26819854 CAGTAGCCATCCTTGGCCTGGGG - Intergenic
1182396630 22:30040910-30040932 CAGAAGCAGCCCTGGGCATGGGG - Intergenic
1184259434 22:43306111-43306133 CAAACGCCACCCAGGGCCCAGGG + Intronic
1184716604 22:46286160-46286182 CAAAAGAATGCCTGGGCCTGGGG - Intronic
1184728701 22:46361109-46361131 CCACGGCCACCCTGGGCATGGGG + Exonic
1185273119 22:49937657-49937679 CCAAAGCCAGCCTGGGGCGGGGG + Intergenic
1185330347 22:50249459-50249481 CAACAGCCAGCCAGGGCCAGAGG + Intronic
950206399 3:11084460-11084482 CAGAAGGCTGCCTGGGCCTGGGG - Intergenic
950502620 3:13373857-13373879 CCACTGCCACCGTGGGCCTGCGG + Exonic
950634925 3:14307907-14307929 CAAAAGCCGCCCTGGACTTCAGG + Intergenic
952060266 3:29499880-29499902 CAAAAAACACACTGGGCCTTGGG + Intronic
952298955 3:32086976-32086998 CACAAGAAACCCTGCGCCTGGGG + Intergenic
952898766 3:38096179-38096201 CAAGAGCAACAATGGGCCTGGGG - Intronic
953663586 3:44908966-44908988 CAAAAGCAACCCTGGGATGGGGG - Intronic
954030947 3:47819546-47819568 CAACAGCCCCTCTTGGCCTGCGG + Intronic
954345380 3:49993202-49993224 CAAATGTTATCCTGGGCCTGAGG + Intronic
954541005 3:51392845-51392867 CAAAATCCACGCGGAGCCTGCGG - Exonic
956229641 3:66998755-66998777 CAAAGGCCAGCCTGCTCCTGCGG - Intronic
957965882 3:87321990-87322012 CAAAAGTCCCTGTGGGCCTGCGG + Intergenic
959234815 3:103706867-103706889 CAACAGCAAGCCTGGGCTTGTGG + Intergenic
961461272 3:127051891-127051913 CAGAAGCCACCGTGGGCTTCAGG + Intergenic
962638763 3:137361294-137361316 AAATAGTCACCATGGGCCTGGGG - Intergenic
963851944 3:150217961-150217983 CCAAAGCCAGCCAGGGCCTGAGG + Intergenic
964132579 3:153306522-153306544 CAAAAAGCACCATGGCCCTGAGG - Intergenic
968570946 4:1340434-1340456 CACCAGCAAGCCTGGGCCTGCGG + Intergenic
969361018 4:6664019-6664041 CCCAAGCCTCCCTGAGCCTGCGG + Intergenic
969690312 4:8700653-8700675 CAAAAGGCACCCTGAGCTCGGGG + Intergenic
969963678 4:10972682-10972704 GGAACGCCACCCTGGGTCTGTGG - Intergenic
972704899 4:41532637-41532659 CAAAAGCCAGCCTGCTCCAGTGG - Intronic
976268168 4:83204830-83204852 AAAGAGGCACCCTGAGCCTGGGG - Intergenic
979395078 4:120178112-120178134 CAATACTCACCATGGGCCTGGGG + Intergenic
979446697 4:120822151-120822173 CAAAAGCCATGCTGGGCCTTGGG + Intronic
980793071 4:137644891-137644913 TCAAAGCCATCCTGGGCCTGTGG - Intergenic
981392735 4:144210842-144210864 CAACAGCCACCCAGTGACTGAGG - Intergenic
983658008 4:170102190-170102212 CTAGACCCACCCTGGGCCAGAGG + Intergenic
985071405 4:186170047-186170069 GAAAAGCCAGCCTGATCCTGAGG - Intronic
985848891 5:2374161-2374183 CAACAGCGACTCTGTGCCTGAGG + Intergenic
985912408 5:2894854-2894876 AAAAAGTCGCCATGGGCCTGGGG + Intergenic
986382575 5:7201429-7201451 TAAAAGCCATTCTTGGCCTGTGG + Intergenic
988405134 5:30814752-30814774 CAAAAGCCACCCAAAGCCAGAGG + Intergenic
988555517 5:32232735-32232757 GAAACTCCACCCTGGGCCTGCGG + Intronic
989602451 5:43212523-43212545 CAGAAGCAACCCTGGGGCTCAGG + Intronic
989629042 5:43461835-43461857 CTAGACCCACCCAGGGCCTGGGG + Intronic
990530653 5:56670083-56670105 CATAAGTCATCCTGGGCCAGTGG + Intergenic
997400994 5:133602234-133602256 CAAAAGCTACCCTGGAGCAGGGG + Intronic
997428894 5:133823811-133823833 CCAAAGCCAGCCTGCCCCTGGGG + Intergenic
998466877 5:142353613-142353635 AAAAACCCACCCTGGGTCTTGGG - Intergenic
1002198296 5:177512955-177512977 CAAAGCCCTCCCTGGTCCTGGGG + Intronic
1002282007 5:178136523-178136545 GAAAAGGCACCCAGGGCCTTGGG - Intronic
1002415038 5:179115953-179115975 CCAAATCCACCAAGGGCCTGTGG + Intronic
1002541847 5:179911405-179911427 CTACTGCCACCCTGAGCCTGGGG + Intergenic
1005622085 6:27629419-27629441 CAATAGACACCCCGGGCCTCTGG - Intergenic
1005706681 6:28461646-28461668 CTAAAGGCACCCTAGGCTTGGGG + Intergenic
1006376293 6:33673378-33673400 GAGAGGGCACCCTGGGCCTGGGG + Intronic
1006395038 6:33781771-33781793 CAAAAGGCCCCCAGGGGCTGAGG - Intronic
1006782753 6:36643320-36643342 TAGAAGCCACCCTGGGCCCACGG + Intergenic
1007076837 6:39073781-39073803 CATCACCCACCCTGGACCTGTGG + Intronic
1007605711 6:43116381-43116403 CACGAGCCGCCCAGGGCCTGTGG - Intronic
1007729080 6:43934960-43934982 AAAAACCCACCCTGAGGCTGTGG + Intergenic
1012243306 6:96898061-96898083 TAAAAGCAACCGTGGGTCTGGGG - Intergenic
1012896242 6:104953222-104953244 CAAACGTCGCCCTGGGCCTTCGG - Intergenic
1013974315 6:116059723-116059745 GAAAATACACCCTGGACCTGTGG + Intronic
1018106968 6:160497578-160497600 CAGCAGCCACTCTGGGACTGAGG + Intergenic
1018132618 6:160747214-160747236 CAAATGCCATCCTAGACCTGGGG - Intronic
1019278918 7:190693-190715 CAAAAACCACTCTGGGGGTGAGG + Intergenic
1020006521 7:4786320-4786342 CAAAGGCCAGCATGGGGCTGTGG - Exonic
1020091778 7:5345875-5345897 CAGAGGCCACTCTGGGCCAGGGG - Intronic
1021999440 7:26211151-26211173 CCAAAGCCATCCTGGGCCACAGG + Intronic
1023343425 7:39246888-39246910 AAAAAGCCACCCTGGATTTGGGG - Intronic
1023866042 7:44238907-44238929 CAGAAGCCAACTTGGGCCTCTGG + Intronic
1026972110 7:74474794-74474816 CAAAACCCCACCTGGGCCTCAGG - Intronic
1027684382 7:81264418-81264440 CAGAAGACACCCTTGGCCTAGGG - Intergenic
1028934647 7:96451540-96451562 CAAAAGCCATCCTGTGCCTTTGG - Intergenic
1029282889 7:99448067-99448089 GAGAGGCCACCCTGAGCCTGGGG - Intronic
1032077704 7:128843924-128843946 CAAGAGCCACCCTGGGAGTGAGG + Intronic
1033409569 7:141105047-141105069 GAAAGGCCACCCTGGGGTTGGGG - Intronic
1033882404 7:145902128-145902150 CTAGACCCACCCTTGGCCTGGGG - Intergenic
1034059376 7:148072546-148072568 CAAAAGCCATTCTTAGCCTGTGG + Intronic
1034584516 7:152077338-152077360 CAAAAGCGGCCCTGGGTCAGAGG - Intronic
1034990963 7:155548063-155548085 CCCAGGCCACCCTGGTCCTGGGG - Intergenic
1035577582 8:717698-717720 CTAAAGCCTTGCTGGGCCTGGGG + Intronic
1040602221 8:48896546-48896568 AAAAAGCCACCCAGGGCCAGAGG - Intergenic
1042652401 8:71057846-71057868 CAAGAGCCACTCTGAGCCTTTGG + Intergenic
1043521419 8:81049933-81049955 CAAACCCCACGCTGGGACTGGGG + Intronic
1044817594 8:96129214-96129236 TTAAAGCCACCCTGGGGGTGCGG - Intergenic
1047821465 8:128525870-128525892 CATAGGCCACACTTGGCCTGTGG + Intergenic
1048322011 8:133407426-133407448 CAAAGGCCACGCTGGCTCTGAGG - Intergenic
1049105693 8:140611095-140611117 CACAAGCCGCTCTGGCCCTGGGG - Intronic
1049196432 8:141318247-141318269 CTGATGCCACCCTGGGCCAGTGG + Intergenic
1049221613 8:141431219-141431241 CAGAGGCCACCCAGGGCCCGAGG - Exonic
1049612709 8:143562827-143562849 CACATGCGGCCCTGGGCCTGCGG - Exonic
1049707715 8:144050607-144050629 CAAAAGCAGCCCTGGGCCCTGGG + Intergenic
1050915696 9:11128320-11128342 CAAGTGCCAACCTGGCCCTGAGG - Intergenic
1051923722 9:22298596-22298618 CAGTACCCACCCGGGGCCTGGGG - Intergenic
1052995422 9:34549490-34549512 CTCCAGCCACCCTGGGCTTGAGG + Intergenic
1057332295 9:94127335-94127357 CAAAAGCAACACTAGGCCAGAGG + Intergenic
1058958126 9:109968212-109968234 CAGAGGCCACCATGGCCCTGGGG + Intronic
1059764362 9:117369924-117369946 AAAGAGGCAACCTGGGCCTGTGG - Intronic
1061806302 9:133139487-133139509 CCCCAGCCACCCAGGGCCTGGGG + Intronic
1062281771 9:135755048-135755070 CCCCAGCCACCCTGGGGCTGGGG - Intronic
1062645717 9:137547200-137547222 CCAAAGCCACCATGCGCTTGAGG + Intronic
1186158020 X:6746019-6746041 ACAAAGCCCCCCTGGGGCTGTGG + Intergenic
1188563742 X:31500423-31500445 CAAATGCCACCTTTGCCCTGTGG - Intronic
1189319080 X:40076481-40076503 CAAAAGCCAGACTGGAACTGAGG - Exonic
1189492946 X:41483793-41483815 CACAAGCCGGCCTAGGCCTGAGG - Intergenic
1190650481 X:52563851-52563873 CAAACACCACCCTGGGGATGTGG - Intergenic
1193194813 X:78619472-78619494 CAATAGCCCCCATGGGTCTGTGG - Intergenic
1193724169 X:85020692-85020714 CAAGAGCCAGCCTGGTGCTGGGG - Intronic
1195781210 X:108466753-108466775 AAAAAGCCACCTTGGCCATGTGG - Intronic
1196735553 X:118978151-118978173 CCCCAGCCACTCTGGGCCTGAGG - Intronic