ID: 1130884767

View in Genome Browser
Species Human (GRCh38)
Location 15:88083712-88083734
Sequence TGGCCTGTTCCCCCATTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130884762_1130884767 19 Left 1130884762 15:88083670-88083692 CCTTCACCCCGCTGGCTCAAAGT 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1130884767 15:88083712-88083734 TGGCCTGTTCCCCCATTTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 118
1130884764_1130884767 12 Left 1130884764 15:88083677-88083699 CCCGCTGGCTCAAAGTCACTGCA 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1130884767 15:88083712-88083734 TGGCCTGTTCCCCCATTTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 118
1130884765_1130884767 11 Left 1130884765 15:88083678-88083700 CCGCTGGCTCAAAGTCACTGCAA 0: 1
1: 0
2: 1
3: 10
4: 180
Right 1130884767 15:88083712-88083734 TGGCCTGTTCCCCCATTTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 118
1130884763_1130884767 13 Left 1130884763 15:88083676-88083698 CCCCGCTGGCTCAAAGTCACTGC 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1130884767 15:88083712-88083734 TGGCCTGTTCCCCCATTTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130884767 Original CRISPR TGGCCTGTTCCCCCATTTGA AGG Intronic
902763410 1:18599203-18599225 GGGCCCGTTCCCCCAGCTGATGG + Intergenic
912411932 1:109485660-109485682 GGGCCTGCTTCCCCATTTAAAGG - Intronic
915959721 1:160255429-160255451 TGGCCTCTTCTCCCTCTTGAAGG + Intronic
916765448 1:167855712-167855734 TGGTCTGGTCCACCTTTTGAAGG - Intronic
917989676 1:180361053-180361075 TGGATTGTCCCCCCATTTGCTGG + Intronic
921356556 1:214289816-214289838 TGGCCTGTTCTGACACTTGAGGG + Intronic
1069090582 10:64195370-64195392 TGACCTGTTTGCCGATTTGAAGG + Intergenic
1071494692 10:86160121-86160143 TGGCTTAATCCCCCAGTTGAGGG - Intronic
1071561220 10:86648395-86648417 TGGCCTGTTCCTCCTTTTGCTGG - Intergenic
1072395202 10:95032683-95032705 TGTCTTGGTCCTCCATTTGAGGG - Intergenic
1072416378 10:95249956-95249978 TGGCCTCTTCCCCCACCTGCAGG + Intronic
1074770668 10:116731438-116731460 TGGCCGCTGGCCCCATTTGAAGG - Intronic
1074903377 10:117839138-117839160 GGGCCTGTTCCCTCATTTTCTGG + Intergenic
1082878590 11:58014840-58014862 CAGCCTGTGCCCACATTTGATGG - Intergenic
1082988145 11:59185419-59185441 TGGCCTGTTCCCTGATATGGAGG - Intronic
1086023542 11:82261609-82261631 AGGCCTGTTCACCCAATTTAAGG + Intergenic
1087837733 11:102891568-102891590 TGGCCTGTACTCCCTTTTAAAGG + Intergenic
1089899546 11:121966455-121966477 TGGACATTTCCCCCATTTAATGG + Intergenic
1091382197 12:69078-69100 TGGTCTTTTCCCCCACATGAGGG + Intronic
1094276424 12:28681302-28681324 TGGCCTGCTCCCTCTTTTTATGG + Intergenic
1096420752 12:51455325-51455347 TGGCTATTTCCCCCACTTGAAGG - Intronic
1097056530 12:56253362-56253384 TGGCGTGTTCCCAAATTTGTCGG + Exonic
1097514947 12:60593589-60593611 TGGAATGTTCCCACATTTGGAGG + Intergenic
1100461715 12:94806263-94806285 TGGCTAGTTCCCCAATTTTATGG - Intergenic
1100740718 12:97588960-97588982 TGCCCTGTTGCTCCTTTTGAAGG - Intergenic
1103494463 12:121350832-121350854 TGGCCTTCTCTCCCATTAGACGG - Intronic
1104360972 12:128132878-128132900 TGGCCAGTGGCCCAATTTGAAGG + Intergenic
1104604937 12:130180832-130180854 AGGCCTGGCCCCCCATGTGATGG - Intergenic
1105001163 12:132689668-132689690 GGGCCTGTTCCACCTTTTTATGG + Intronic
1107926512 13:45267910-45267932 TGGCCTGTTCCCCATTTTTAAGG + Intronic
1108582945 13:51842270-51842292 TTGCCTTTTCCCCCATTAGCAGG + Intergenic
1113960543 13:114123434-114123456 TGGCCTTTTCCCTGCTTTGAGGG - Intronic
1115031055 14:28794405-28794427 TGCTGTGTACCCCCATTTGATGG + Intronic
1119408367 14:74412563-74412585 TGTCCTCTGCCCCCTTTTGAGGG + Intronic
1120813626 14:88830337-88830359 TGTCCTGTTACCCACTTTGAGGG + Intronic
1122016874 14:98803761-98803783 TGGCATGATCCCCATTTTGAAGG + Intergenic
1122532761 14:102440296-102440318 TGGCCTCTTTCCCCACTTGGGGG + Intronic
1122781454 14:104145561-104145583 TGGCCTCTGACCCCATGTGATGG + Intronic
1202850170 14_GL000225v1_random:11614-11636 TGCACTGTTCACCCATGTGATGG - Intergenic
1125382283 15:39099542-39099564 TTGCCTTTTCCCCACTTTGAAGG - Intergenic
1125724896 15:41863202-41863224 AGGCCTGTGCCGTCATTTGAGGG + Intronic
1126757871 15:51941973-51941995 TGGCCCTTGCCCCCATTTCAAGG + Intronic
1129320266 15:74770863-74770885 TGGGCTGCTCCCTGATTTGAAGG - Intergenic
1130884767 15:88083712-88083734 TGGCCTGTTCCCCCATTTGAAGG + Intronic
1134239257 16:12493167-12493189 TGGAATGTTCTTCCATTTGATGG + Intronic
1134884295 16:17776074-17776096 TGGCCTGTTCTACAATTAGAGGG + Intergenic
1137270692 16:46900666-46900688 TGTCTTGTTCCCCCAGGTGATGG + Exonic
1139188456 16:64834701-64834723 TTGCCTTTTCATCCATTTGAAGG - Intergenic
1148816465 17:50331503-50331525 TGGTCTGTTCCCCCATGGTAAGG - Intergenic
1149478527 17:56983556-56983578 TAACCTGTTCCCCTATTTGGGGG + Intronic
1149992386 17:61390294-61390316 TGGCCTGTCCCCCCAGATTAGGG + Intronic
1152179712 17:78811570-78811592 CGGCCTGTTCTCACATTTAACGG - Intronic
1152771081 17:82169641-82169663 TGGCCCCTTCCCCTATTTGCAGG - Intronic
1158162178 18:54497357-54497379 TGGAGTGTTCCCACATTTGTGGG + Intergenic
1158491357 18:57912425-57912447 TGGCCTGCTCCCATATTGGATGG - Intergenic
1159726891 18:71971985-71972007 GTGCCTGCTCCCCCATGTGATGG - Intergenic
1163133872 19:15295054-15295076 TGGGCTGTTGCCCCCTTTTATGG - Intronic
1163239752 19:16053561-16053583 TTGCCCCTTCCACCATTTGAAGG - Intergenic
1163422531 19:17222177-17222199 TGGCCTATTCCTCATTTTGATGG - Intergenic
1168708647 19:58484542-58484564 TGGCCCCTTCCCCCATGTGGTGG + Intronic
925779631 2:7370270-7370292 TGGCCTCTGCCGCCATCTGAAGG + Intergenic
928030523 2:27774559-27774581 AGGCCTGTTGCCCCCTTTGTAGG + Intronic
928470714 2:31573090-31573112 TGGCCTGTTCCCAGATTTCTGGG - Intronic
934925557 2:98379844-98379866 TGAGCTAATCCCCCATTTGAAGG + Intronic
942792487 2:179776382-179776404 AGGCCTGTCACCCCATTTCAAGG - Intronic
948316857 2:237034345-237034367 TTGACTGTCCACCCATTTGAGGG - Intergenic
1169387890 20:5166568-5166590 CAGCCTGTCCCCGCATTTGAGGG - Intronic
1172375087 20:34432623-34432645 TGACCTGTTCTCCCATTTGCTGG - Intronic
1172632713 20:36390006-36390028 TGGCTGTTTCCCCCATTAGAAGG - Intronic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1175437652 20:58965607-58965629 CTGCCTGTTCCCCCAGTTGAAGG + Intergenic
1176283003 20:64325755-64325777 TGGTCTTTTCCCCCACATGAGGG - Intergenic
1176914693 21:14610740-14610762 TGGCGGGTTCCCCCATATCAGGG + Intronic
1185286963 22:50005875-50005897 TGGCCGGGTCTCCCATATGAGGG - Intronic
950935690 3:16836635-16836657 TGGCCTTTTCCCTGATTTCAGGG - Intronic
952966792 3:38625968-38625990 GGGCCTGTTCCCCCACTCTAAGG - Intronic
953134655 3:40172176-40172198 TGGCATGTTTCACCATTAGATGG - Intronic
959601548 3:108191925-108191947 TGGCTTGTTGGTCCATTTGATGG - Intronic
961696063 3:128705786-128705808 TGGCCTGTTCCCAGCTTTAAAGG + Intergenic
969974863 4:11088119-11088141 TACCCTTTTCCCCCATTTGGTGG - Intergenic
971011808 4:22446305-22446327 TGGCAATTTCCCCCATTTGGGGG + Intronic
972360304 4:38320287-38320309 TGGCCTCTGCCCCTATGTGAGGG + Intergenic
977359890 4:95988719-95988741 TGGCTTCTTCTTCCATTTGAGGG - Intergenic
977413595 4:96699847-96699869 TGCCCTGTTCCACAATTTGATGG - Intergenic
977780905 4:100979742-100979764 AGGCATGTTCCACCATATGAAGG + Intergenic
978828930 4:113059024-113059046 TTGCCTTTTCCACCATGTGAAGG - Intronic
979194980 4:117910140-117910162 TGACCTGTGCCCACTTTTGATGG + Intergenic
980760993 4:137234056-137234078 TGGCCAGTTCTCCCCTTTCAAGG + Intergenic
984171659 4:176367676-176367698 TGCCCTTTTCCCCCATTTCTAGG + Intergenic
984636123 4:182111673-182111695 AGGCCAGTTTCCCCATTTCAAGG + Intergenic
990401760 5:55445138-55445160 TGGCCTGATCCCCAATATCATGG + Intronic
996646363 5:125823055-125823077 TGGCCTGATCCTCCATAGGATGG + Intergenic
998612810 5:143707497-143707519 TGGGTTGTTACCTCATTTGAAGG + Intergenic
998812387 5:145979181-145979203 TAGCCAGTTCCCCCAGGTGATGG - Intronic
998863757 5:146473521-146473543 TGGCATGTTCTCCCAATAGAAGG - Intronic
1001004536 5:168038789-168038811 TGGCCTGTTCCCCCAGTTTCAGG + Intronic
1001004560 5:168038871-168038893 TGGCATGTTCCCCCAGTTTCAGG + Intronic
1001710798 5:173776333-173776355 TGGCCTCTTCTGCCATGTGAGGG + Intergenic
1002561799 5:180087548-180087570 TGGCCGATTCTCCCATTTTAAGG - Intergenic
1007454225 6:41963783-41963805 TGGTTTCTTCCTCCATTTGATGG - Intronic
1014634241 6:123825097-123825119 TGGCCTCTTCCACCACATGAAGG - Intronic
1017754945 6:157521555-157521577 TGGCCTCTCCCACCATGTGAGGG - Intronic
1018791358 6:167150520-167150542 TGGCCTTTTCCACCATGTGAGGG + Intronic
1019714067 7:2530328-2530350 GGGCCTGCTTCCCCTTTTGAGGG - Intergenic
1019849322 7:3538629-3538651 TGGTCAGTTCTCCCATTAGAAGG - Intronic
1024196146 7:47060776-47060798 TTGCCTTTTCCACCATATGAGGG + Intergenic
1024292606 7:47815779-47815801 TTGCCTGTTTCCCCATAGGAGGG - Intronic
1025144290 7:56491513-56491535 TGGAATCTTCCCCCATTTGACGG - Intergenic
1029296347 7:99543451-99543473 GGGTCTGTTCCGCCATTTGCCGG + Intergenic
1030671707 7:112345283-112345305 TGGCCTGATCACCCTTCTGAAGG + Intergenic
1032399869 7:131617244-131617266 TCTCCTGTTCCCCCATTTCATGG + Intergenic
1033140256 7:138820314-138820336 AGGCCTGTTTCCCCATCTGAAGG + Intronic
1034069751 7:148172784-148172806 AGGCCTGATTCCCCTTTTGAAGG - Intronic
1034439553 7:151079789-151079811 AGGCCGGTCCCCCCATTTGCTGG + Exonic
1042157716 8:65863675-65863697 TGGCCTGCTCTCCCAGGTGAAGG - Intergenic
1043705213 8:83340595-83340617 TGGACTGTTCTTCCATTTGTTGG + Intergenic
1045457525 8:102396218-102396240 TGGCCAGTTCTGCCATTTTAAGG - Intronic
1048877172 8:138845958-138845980 TGGCCTCTTCTCATATTTGAGGG + Intronic
1049440846 8:142608937-142608959 TGGCCTGTTCCACAATTACAGGG + Intergenic
1051264844 9:15300350-15300372 TGGCCTGTCCCCCAGTTTGAGGG - Intronic
1053534754 9:38914354-38914376 TGGCCGGTTTCCCCATTACAGGG - Intergenic
1054631376 9:67449573-67449595 TGGCCGGTTTCCCCATTACAGGG + Intergenic
1055648587 9:78384708-78384730 TGGAATTATCCCCCATTTGATGG + Intergenic
1059724414 9:116992060-116992082 TGGCCTCTTGCCACATGTGAAGG - Intronic
1061092795 9:128435946-128435968 TGGCTTGCTCTCCCCTTTGATGG + Intronic
1188442119 X:30223079-30223101 AGGCCTGTCTCCCCATATGAAGG - Intergenic
1192023454 X:67422301-67422323 TGGCCTGTTCTCTCTGTTGATGG + Intergenic
1193772022 X:85599053-85599075 TGTCCTTATCCCACATTTGATGG - Intergenic
1196067153 X:111476869-111476891 TGGCATGTTCTTCCATTAGAAGG + Intergenic
1201125838 Y:10913316-10913338 TGCACTGATCACCCATTTGAAGG - Intergenic