ID: 1130886254

View in Genome Browser
Species Human (GRCh38)
Location 15:88095011-88095033
Sequence TAGCCACAGCTCCCAGGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130886254_1130886260 3 Left 1130886254 15:88095011-88095033 CCATTACCTGGGAGCTGTGGCTA 0: 1
1: 0
2: 1
3: 15
4: 190
Right 1130886260 15:88095037-88095059 CCAAATTGATGGCACTCTGGCGG 0: 1
1: 0
2: 0
3: 4
4: 90
1130886254_1130886258 0 Left 1130886254 15:88095011-88095033 CCATTACCTGGGAGCTGTGGCTA 0: 1
1: 0
2: 1
3: 15
4: 190
Right 1130886258 15:88095034-88095056 TGGCCAAATTGATGGCACTCTGG 0: 1
1: 0
2: 0
3: 12
4: 111
1130886254_1130886257 -8 Left 1130886254 15:88095011-88095033 CCATTACCTGGGAGCTGTGGCTA 0: 1
1: 0
2: 1
3: 15
4: 190
Right 1130886257 15:88095026-88095048 TGTGGCTATGGCCAAATTGATGG 0: 1
1: 0
2: 0
3: 18
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130886254 Original CRISPR TAGCCACAGCTCCCAGGTAA TGG (reversed) Intronic
901663786 1:10815120-10815142 GAGCCACAGCTCCAAGGCCAGGG - Intergenic
902748615 1:18490535-18490557 TAGCAACAATCCCCAGGTAATGG - Intergenic
905582224 1:39090902-39090924 TAGCCACAGCAACCAGAAAAAGG - Intronic
907158554 1:52355515-52355537 CAGCCACACCTCCCAGGGATGGG + Intronic
907442163 1:54485823-54485845 CAGCCACGGGTCCCAGGTCAAGG - Intergenic
907823130 1:57990136-57990158 TCTCCTCAGCTCCCAGGAAATGG + Intronic
910961585 1:92769521-92769543 TAGTCACAGGTTCCAGGTATTGG - Intronic
911283545 1:95960837-95960859 GAGCCACTGCACCCAGCTAAAGG + Intergenic
915535792 1:156534601-156534623 GAGCCACAGCCCCCAGGGCATGG + Exonic
916666272 1:166970572-166970594 AATCCTCAGCTCCCAGGTCAGGG + Intronic
916685777 1:167144292-167144314 TAGACCCAGCTACCAGGTGAGGG - Intergenic
917362281 1:174190018-174190040 TAGCCACTGCACCCAGCCAAGGG - Intronic
917801796 1:178578284-178578306 GAGCATCAGCTCCCAGGCAAGGG + Intergenic
922479328 1:225928130-225928152 TGGCCACAGCACCAAGGAAATGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924251853 1:242140886-242140908 GAGCCACAGCTCACAGGTGATGG + Intronic
1064095775 10:12423604-12423626 TATCCAGAACTCCCAGGTACAGG + Intronic
1067350234 10:45469050-45469072 TTGCCTCAGCTCCAAGGTGATGG - Intronic
1067440420 10:46306144-46306166 CAGGCAAAGATCCCAGGTAAAGG - Intronic
1067527644 10:47048086-47048108 TGGCCACAGGTCCCAGGTTGGGG - Intergenic
1067749987 10:48964953-48964975 TTTGCTCAGCTCCCAGGTAAAGG + Intronic
1068266698 10:54658913-54658935 TATCCACAGCCCCAAAGTAAAGG + Intronic
1069211750 10:65770277-65770299 TGACCTCAGGTCCCAGGTAAAGG + Intergenic
1069853710 10:71426859-71426881 GAGCCACTGCGCCCAGCTAAAGG - Intronic
1071680419 10:87699565-87699587 GAGCCACCGCTCCCAGACAATGG - Intronic
1071872952 10:89815323-89815345 CAGGAACAGCTCCCAGGGAAGGG - Intergenic
1077171316 11:1167432-1167454 TACCCTCACCTCCCAGGTCATGG + Intronic
1080943152 11:36941865-36941887 TAGCCACAGCTCATTGGTCAAGG - Intergenic
1082799786 11:57406169-57406191 TAGCCCCAGCACCCAGGACAGGG + Intronic
1083373741 11:62203018-62203040 GAGCCACAGGTCCCTGGGAAAGG + Intergenic
1083751082 11:64760900-64760922 TAGCCAAAGCCTCCAGGGAAGGG - Intergenic
1085756291 11:79204433-79204455 TAGTCACAGCTCCCAGAGATAGG - Intronic
1091121929 11:133064409-133064431 TTGCCACAGCTACCAGGGAAAGG - Intronic
1091338523 11:134792705-134792727 AAGCCACACCCTCCAGGTAATGG - Intergenic
1092109617 12:5949779-5949801 TATCCACTACTGCCAGGTAAGGG - Exonic
1096629173 12:52914621-52914643 GAGCCCCAGCTCCCAGCCAAAGG + Intronic
1097084020 12:56454316-56454338 CAGCCACAGCTCCCAGGAGCTGG + Exonic
1097895688 12:64822957-64822979 CACCCACAGCACCCAGGTTATGG - Intronic
1099066636 12:77988763-77988785 TAGACACAGCTCTCAGGCAATGG - Intronic
1100052865 12:90471468-90471490 TAGCCACAGCTCCAAGGTTGGGG + Intergenic
1103951231 12:124552460-124552482 CAGCCACAGCCCCCAGGTCAAGG + Intronic
1112400705 13:99075647-99075669 TAGCCACTGCACCCAGACAATGG + Intronic
1114377697 14:22166195-22166217 TAGCCACAGATCCCAGCAAAAGG + Intergenic
1114630273 14:24155100-24155122 AAGCCACAGCTGCCAGGCTAGGG - Intronic
1115340041 14:32283724-32283746 TAACCACTGTACCCAGGTAATGG - Intergenic
1115464788 14:33703201-33703223 AAGCCACTGCTCCCAGCCAAGGG - Intronic
1116428431 14:44818640-44818662 TCACCACAACTCCCAGGTAGTGG + Intergenic
1120126647 14:80751913-80751935 GAGCCACCGCACCCAGGTAATGG + Intronic
1120367153 14:83585694-83585716 TAGCCACAGCAATCAGGCAAGGG - Intergenic
1122165490 14:99820210-99820232 TAGCCCCTGCTCCCATGTATAGG - Intronic
1122236548 14:100333628-100333650 GTGCCACAGCTCCCAGGAATGGG - Intergenic
1122366729 14:101198784-101198806 TAGCCACAGCTCCCAGTCATGGG + Intergenic
1123155698 14:106223304-106223326 TAGGCCCAGCTCCCATGTCAAGG + Intergenic
1123771924 15:23537627-23537649 TAGCCTCAGCACCAAGGTAGGGG - Intergenic
1124845359 15:33284625-33284647 GAGCCACATGTCCTAGGTAATGG - Intergenic
1126287591 15:47031352-47031374 TAGCCAGAGCAATCAGGTAAAGG + Intergenic
1129568834 15:76656178-76656200 TAGCCACAGGTTCAAAGTAAAGG + Intronic
1129990691 15:79959893-79959915 TATCAACAGCTTCCAGGGAAAGG + Intergenic
1130886254 15:88095011-88095033 TAGCCACAGCTCCCAGGTAATGG - Intronic
1132729417 16:1353952-1353974 TAGCCACAGATCAGAGATAAAGG + Intronic
1133552135 16:6866824-6866846 GAGCCACCGCGCCCAGCTAAAGG + Intronic
1133732534 16:8589584-8589606 CAGCCACAGCTCCCAGCCACGGG + Intronic
1134359308 16:13516513-13516535 GAGCCACTGCTCCCAGTTACTGG - Intergenic
1134445788 16:14330439-14330461 GAGCCACCGCGCCCAGCTAAAGG - Intergenic
1137396711 16:48120836-48120858 GAGCCACTGCGCCCAGCTAATGG + Intronic
1137764152 16:50964673-50964695 GAGCCACAGCTTCCAGGAACAGG - Intergenic
1138333122 16:56231119-56231141 AAGCCACACTGCCCAGGTAATGG - Intronic
1138664953 16:58558466-58558488 TCATCACAGCTTCCAGGTAAGGG - Exonic
1139156928 16:64454737-64454759 TGGCTACAGATGCCAGGTAAAGG + Intergenic
1139284051 16:65795239-65795261 TAGCCACTGTTCCCAGACAAGGG + Intergenic
1139874160 16:70131898-70131920 TAGTCAAAGCTTCTAGGTAAGGG + Intronic
1140361617 16:74349246-74349268 TAGTCAAAGCTTCTAGGTAAGGG - Intergenic
1140479802 16:75256479-75256501 TGGGCAGAGCTGCCAGGTAAGGG + Intronic
1141424477 16:83936116-83936138 GAGACACAGCTCCCAATTAAGGG + Intronic
1143276363 17:5714202-5714224 TAGCCACAACTCACAGACAAGGG + Intergenic
1143516722 17:7422918-7422940 TAGCCACTGCGCCCAGCCAAGGG - Intergenic
1146921058 17:36712130-36712152 TAGGCACAGCCCACAGGAAATGG - Intergenic
1147991203 17:44334537-44334559 TAGCCACCCCTCCCAGGGGAAGG + Intergenic
1148377649 17:47163414-47163436 GAGCCACAGCACCCAGCCAAGGG - Intronic
1148521817 17:48284011-48284033 TAAACTCAGCTCACAGGTAAAGG + Intronic
1148829936 17:50425107-50425129 GAGCCAGAGTTCCCAGATAAGGG + Intergenic
1149689271 17:58560486-58560508 TAGCCACAGCTATCTGATAAAGG - Intronic
1150665005 17:67126078-67126100 TTTCCAGAGCTTCCAGGTAAGGG + Intronic
1150691326 17:67369644-67369666 GAGCCACAGCGCCCAGCTGAAGG + Intergenic
1151591846 17:75049966-75049988 GAGCCAAAGCTCCCAGATCAGGG - Intronic
1151621605 17:75248909-75248931 TAGCGACAGCTGCCAGGCAGAGG + Intronic
1151833109 17:76567355-76567377 GAGTCCCAGCTCCGAGGTAAGGG + Intronic
1152048957 17:77958282-77958304 GAGCCACAGCGCCCAGGGACCGG + Intergenic
1153797210 18:8634728-8634750 TACCCACACCTCCCTGATAAGGG + Intronic
1154430929 18:14307931-14307953 TATCCACAGTTCCCAGGAATTGG - Intergenic
1155043191 18:22082271-22082293 TAGCCACTGCTCCCAGCCACTGG + Intergenic
1155229480 18:23758556-23758578 TAGCCTCAGCCCCCAGGGAGAGG - Intronic
1156837809 18:41576052-41576074 TAGACCTAGCTCCCAGGTATGGG + Intergenic
1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG + Intergenic
1157612503 18:48966924-48966946 AAGCCACAGCGCCCAGCTGATGG - Intergenic
1159946916 18:74450760-74450782 TGGCCACAGCTGCCAGGTTCCGG + Intronic
1160504347 18:79418588-79418610 GAGCCACAGCTCCCTGGAGAAGG + Intronic
1161222805 19:3125814-3125836 GAGCCACAGCGCCCAGCCAATGG + Intergenic
1161701794 19:5799939-5799961 CAGCCACAGGTCGCAGGTCAAGG - Intergenic
1164169936 19:22716242-22716264 TAGCCACTTCACCCAGGTGATGG + Intergenic
1164989172 19:32672475-32672497 AAGCCCCAGCTCCCAGGGAGAGG + Intronic
1165062050 19:33209572-33209594 AGGCCTCAGCTCCCAGGGAAGGG - Intronic
1168233736 19:55049021-55049043 GAGGCACAGCTCCAAGGTGAGGG + Intronic
927865418 2:26584657-26584679 AAGCCACAGCTGTCAGATAAAGG + Intronic
927951124 2:27170186-27170208 TAGCCACCGCGCCCAGCCAAGGG - Intergenic
928219811 2:29394478-29394500 TCCCCACAGCTCCCTGGTGAGGG - Intronic
931637131 2:64351076-64351098 AAGCCACTGCTGCCAGGTGATGG - Intergenic
934535478 2:95129719-95129741 GAGCCACTACTCCCAGGCAATGG - Intronic
934995791 2:98958146-98958168 GAGCCACAGCGCCCAGCCAAAGG + Intergenic
936821182 2:116523420-116523442 TAGCCAGAGCACTCAGGCAAAGG - Intergenic
937281429 2:120719892-120719914 TAGACGCGGCTCCCAGGTCATGG + Intergenic
938034971 2:128027933-128027955 TGGGCGCAGCACCCAGGTAATGG - Intronic
942683624 2:178507892-178507914 TAAAAACAGATCCCAGGTAAAGG - Exonic
943508393 2:188792546-188792568 GAGCCACTGCTCCCAGCCAAGGG - Intergenic
945046896 2:205789591-205789613 AGGCCACAGCTCCCTGGAAAGGG - Intronic
945582356 2:211611174-211611196 GAGCCACAGCTGCAAGCTAAGGG + Intronic
948811592 2:240481158-240481180 CAGGCACAGCTCCCAGGCAGCGG - Intronic
1168912920 20:1464322-1464344 GAGGCACAGCCCCCAGGTAAGGG - Exonic
1169777083 20:9267136-9267158 TAGTCACAGTTCCTAGGTACTGG + Intronic
1170162150 20:13324238-13324260 CAGCCCCACCTCACAGGTAAGGG + Intergenic
1170805574 20:19627911-19627933 GAGCCACAACTCCCAGCTGAGGG - Intronic
1172121004 20:32598704-32598726 TCACCTCAGCTCCCAGGGAAGGG - Intronic
1172486659 20:35302437-35302459 CAGCCACAGATCCCAGCTCATGG - Intergenic
1173216175 20:41086533-41086555 GAGCCAAAGCTCCGAAGTAAAGG - Intronic
1174277994 20:49417512-49417534 AAGCCTCAGCTCCCAGGAAGGGG + Intronic
1174797021 20:53530802-53530824 TAGCCATAACTCCCATGAAATGG + Intergenic
1175180153 20:57140645-57140667 TAGCATCAGCTCCCAGGTGAGGG + Intergenic
1176910314 21:14557592-14557614 TATCCCCAGCTACCAGTTAAGGG + Intronic
1180078836 21:45477235-45477257 GAGCTCCAGCTCCCAGGCAAAGG - Intronic
1183490155 22:38111708-38111730 TAGTCCCAGCCCCCAGGGAACGG + Exonic
1183997346 22:41645014-41645036 GAGCCACAGCCCCCAGCTCAAGG - Intronic
1184034858 22:41913588-41913610 ATGCCACAGCTCCCAGGTGAAGG - Intronic
1184068560 22:42134603-42134625 TGGCCACAGCTCGCAGGGAATGG - Intergenic
950689201 3:14642174-14642196 AAACCACAGCACCCAGGTATTGG - Intergenic
953881510 3:46693636-46693658 CAACCACAGCGCTCAGGTAAGGG - Exonic
954976013 3:54695579-54695601 TAGCAACAACTAGCAGGTAAGGG - Intronic
959077702 3:101767073-101767095 GAGCCACTGCTCCCAGCTCATGG + Exonic
959101782 3:102018359-102018381 TAGCAGCATCTCCCTGGTAAAGG + Intergenic
960876106 3:122296509-122296531 AAGCCACAGCTCCCACCTTAGGG - Intergenic
961387469 3:126530520-126530542 CAGCCACAGTTCCCAGGAAAGGG + Intronic
963921857 3:150913340-150913362 GAGCCACAGCTGCCAGGAGATGG - Intronic
966129705 3:176623644-176623666 TCTCCACAGTTCCCAGGAAAAGG + Intergenic
967438441 3:189478097-189478119 TATCCACAGCTCAGAGGAAAAGG - Intergenic
968272899 3:197418469-197418491 TAGGAAGAGCTGCCAGGTAAAGG + Intergenic
974052857 4:56957355-56957377 TTACCACAGCTACCAGGTAGAGG + Intergenic
974684922 4:65215437-65215459 TAGCCATGGCTCCAAGGTTAGGG - Intergenic
978854800 4:113382224-113382246 TAGCCACTGCTCCCAGTTAAAGG + Exonic
980291903 4:130855195-130855217 TAGCCACAGCCCACAGGCAGGGG - Intergenic
984760264 4:183357295-183357317 TAGCCACAGTTTTCAGGTGAGGG - Intergenic
986742482 5:10716062-10716084 TGGCCACAGCTATCAGCTAAAGG - Intronic
988356778 5:30186496-30186518 TAGTCACACATCCCAGGTGAGGG - Intergenic
993205317 5:84871334-84871356 AAGCCACAGGTCCCTGGTAGAGG + Intergenic
997284911 5:132670961-132670983 GAGCCACACCTCACAGGTGAGGG - Intergenic
997478324 5:134162669-134162691 GAGCCACTGCACCCAGCTAAGGG + Intronic
1001537203 5:172506514-172506536 AAGGTACTGCTCCCAGGTAAAGG - Intergenic
1001577897 5:172776374-172776396 CAGCCACAGATACCATGTAAAGG - Intergenic
1002828136 6:792435-792457 TAGCAACAGCTACCAGGTCTTGG - Intergenic
1002830816 6:818873-818895 TAGCCACAGCTTCAGGGCAATGG + Intergenic
1004560455 6:16744492-16744514 TACCCACTGCTCCCAGGACAGGG + Intronic
1008084628 6:47231280-47231302 GAGCCACAGTTCCCAAGCAAAGG - Intergenic
1013766227 6:113577482-113577504 GAGCCACTGCACCCAAGTAAAGG - Intergenic
1014143244 6:117967752-117967774 TAGACACAGCTACCAAGAAAGGG + Intronic
1018284836 6:162226339-162226361 TATCCACAGCACCCAGGAAGGGG - Intronic
1019336537 7:485483-485505 AAGCCACAGCTCCCAGGCTGGGG + Intergenic
1019505144 7:1386807-1386829 TGGCCACAGCACCCAGGCAGCGG + Intergenic
1019990416 7:4686512-4686534 TCGCCAGAGCTCCCAGGCACAGG + Intronic
1022639829 7:32171127-32171149 TACCCACAGTTCCCAGGAGAGGG - Intronic
1026795672 7:73364495-73364517 TAGACACAGTCCCCAGGAAAGGG + Intergenic
1027159139 7:75789710-75789732 GAGCCAAAGACCCCAGGTAAGGG - Exonic
1029136535 7:98376534-98376556 GAGCCACCGCTCCCAGCCAATGG - Intronic
1034845080 7:154437082-154437104 TAGTCACAGGTACCAGGGAATGG - Intronic
1036482481 8:9151066-9151088 CAGCCGCAGCTCCCGGGTCACGG + Intronic
1037398167 8:18465396-18465418 TAGCCAGAGCTATCAGGCAAGGG - Intergenic
1038651657 8:29409386-29409408 TAGCCACAGATCTAGGGTAAAGG + Intergenic
1038690898 8:29762412-29762434 TAGCCACAGCTCACAAGACAGGG + Intergenic
1039641200 8:39225169-39225191 GAGCCACAGCTCCAGGGTCAGGG - Intronic
1041678713 8:60564288-60564310 TACCCACAGCACCAAGGGAAAGG - Intronic
1045868807 8:106901906-106901928 TAGCCAGAGCAATCAGGTAAGGG - Intergenic
1047957014 8:129984017-129984039 TACAGACAGCTCCCAGGTGATGG + Intronic
1048096834 8:131305473-131305495 TAGCCAGAGCAATCAGGTAAGGG - Intergenic
1048335016 8:133496315-133496337 CAGCCACAGGTCTCAGGTGAAGG + Intronic
1048627125 8:136197502-136197524 TAGACACAGCTCCCACGAGAGGG + Intergenic
1051365206 9:16316960-16316982 GAGCCTCAGCTCCCAGGAGAAGG - Intergenic
1051776474 9:20639594-20639616 GAGCCACAGCTCCCAGCTCCAGG + Intergenic
1052753476 9:32516306-32516328 TGGCTACAGCTCCCAATTAAAGG + Intronic
1052990687 9:34517870-34517892 GACCCACAGCTCCCAGCTCAGGG - Intronic
1053202686 9:36163493-36163515 CAGCCACAGCTGCCAGGAACAGG - Exonic
1055330123 9:75174942-75174964 TAGCAACAGCTATCAGGCAAAGG - Intergenic
1055432475 9:76258041-76258063 TTTCCACAGCTCCCAGGTACAGG + Intronic
1056146182 9:83731671-83731693 GAGCCACCGCGCCCATGTAAAGG + Intergenic
1057211320 9:93202541-93202563 GAGCCACAGCTCTCAGGGAGGGG + Intronic
1061266951 9:129511679-129511701 TGGCCTCAGCTTCCAGGGAAGGG + Intergenic
1061744234 9:132727974-132727996 TACTCACAGCTCCCAGGAAAAGG - Intronic
1062082336 9:134630633-134630655 GGGCCACAGCGCCCAGGTGAAGG - Intergenic
1186498198 X:10029327-10029349 GAGCCACTGCACCCAGCTAAGGG - Intronic
1188685052 X:33059440-33059462 TGGGCACAGCTACCAGGAAAAGG + Intronic
1190329489 X:49226825-49226847 TAGCCCCAGCCCCCAAGTTATGG - Intronic
1190432814 X:50394151-50394173 AAGCCACAGCTCCGAGGTCTGGG - Intronic
1192551206 X:72055174-72055196 AATCCAGAGCTCCCAGTTAATGG + Intergenic
1193918376 X:87395958-87395980 GAGCCACCGCACCCAGCTAATGG - Intergenic
1194151203 X:90326515-90326537 TAGCCACAGATCCTAGTTCAGGG - Intergenic
1194492774 X:94571517-94571539 TCACCACAGCGCCTAGGTAAGGG - Intergenic
1195640125 X:107164814-107164836 GAGCCACTGCGCCCAGCTAAAGG - Intronic
1196113696 X:111974707-111974729 TAGTCACAGCTCTCTGGTGATGG - Intronic
1198486786 X:137095291-137095313 TAGCCACTGCCCCCAGCTACTGG - Intergenic
1200089230 X:153626560-153626582 CAGCCACAGCGCCCCGGTGAAGG - Intergenic
1200497573 Y:3903269-3903291 TAGCCACAGATCCTAGTTCAGGG - Intergenic