ID: 1130888158

View in Genome Browser
Species Human (GRCh38)
Location 15:88111002-88111024
Sequence GGCTGTGCAAGAGCATGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130888158 Original CRISPR GGCTGTGCAAGAGCATGGAG GGG Intronic
903271630 1:22192093-22192115 GGTGGTGCAGGAGCATGGGGAGG + Intergenic
904266873 1:29323350-29323372 GGCTGGGCATAAGCACGGAGAGG - Exonic
906214611 1:44031434-44031456 GGCTGTGGAAGAGCTGCGAGCGG - Intronic
907116590 1:51974115-51974137 GGTTGTGAAAGAGCAGAGAGTGG - Intronic
907551109 1:55305445-55305467 GCCTGTGCAAAAGGCTGGAGAGG - Intergenic
907851847 1:58262259-58262281 GGCTGTGCAAGCCCAAGGAAAGG + Intronic
913360861 1:117978683-117978705 GGCAGTTTCAGAGCATGGAGGGG - Intronic
915361846 1:155290545-155290567 GGCTGGGCCAGAGGAGGGAGGGG + Exonic
915733910 1:158072620-158072642 GCCTGTGCAAGGGCATGAAGAGG + Intronic
915850911 1:159321872-159321894 GGCTATGCAAAAACATGTAGTGG - Intergenic
915943370 1:160133136-160133158 GGCTGGGAAAGAGCATGCAGAGG + Intronic
916332082 1:163628355-163628377 GGATGGGGAAGAGGATGGAGGGG - Intergenic
916823351 1:168421771-168421793 GGCTTTGCATGAGGATGGAATGG + Intergenic
917473991 1:175352577-175352599 ACCTTTGCAAGAGCATGGAGGGG + Intronic
918612090 1:186504450-186504472 GGCTGTGAAAGACCATTGAAGGG + Intergenic
918887862 1:190220010-190220032 AGCTGAGCAAGATCAAGGAGTGG + Intronic
919237589 1:194866265-194866287 GGCTGTACAGGAGCATGGCTGGG - Intergenic
919814911 1:201431202-201431224 GGCTTTGGAGGAGAATGGAGCGG - Intergenic
919857973 1:201718594-201718616 GGCTGCGCATGGGCATGGTGTGG - Exonic
919920657 1:202164706-202164728 GGCTGTGGGAGAGCAGGGAGGGG + Intergenic
920172898 1:204082616-204082638 GGCTGAGGAAGAGAAAGGAGAGG + Intronic
920491426 1:206418430-206418452 GCCTTTGCAAGAGCTTGGATAGG + Intronic
921005008 1:211084615-211084637 GGCTGAGCAAGGGCATGGGAAGG + Intronic
921264408 1:213410517-213410539 GGTTGTTGAAGAGGATGGAGAGG + Intergenic
924804193 1:247349405-247349427 GGCTGTGCTAAAGCAAGCAGTGG - Intergenic
1062787198 10:274953-274975 GGTTGTGCAAGAGAAAGGAAAGG - Exonic
1063130509 10:3173231-3173253 GGCTGTGCAAGTGATGGGAGGGG + Intergenic
1064004765 10:11691040-11691062 GTCCGTGGAAGAGCATGGTGAGG + Intergenic
1064094049 10:12409368-12409390 GGCTGTGATAGAGGATAGAGGGG + Intronic
1066763771 10:38784227-38784249 GGATTTGCAATAGTATGGAGTGG - Intergenic
1067552671 10:47246452-47246474 GTGTGTGCATGTGCATGGAGAGG - Intergenic
1068082707 10:52339577-52339599 GGCTGTACAAAAGCAGGGGGTGG + Intergenic
1070733787 10:78849872-78849894 GGGTGTGGGAGAGGATGGAGAGG - Intergenic
1072706770 10:97686824-97686846 GGCTGTGGAAGAGGTTGGAGTGG - Exonic
1073297816 10:102451460-102451482 GGCTGAGGCAGGGCATGGAGCGG - Exonic
1073448197 10:103593342-103593364 GGCTGTGCAAGGCCATGCAGAGG - Intergenic
1074445358 10:113517255-113517277 GGCTGGGCCAAAGCCTGGAGTGG - Intergenic
1076548885 10:131264560-131264582 GGCTAAGCAAGAGCCTGGTGTGG - Intronic
1081642431 11:44765313-44765335 GGTTGTGGAAGGCCATGGAGAGG + Intronic
1083198573 11:61105645-61105667 GCCTGTGCAAGAGGATTGAGGGG - Intronic
1083674449 11:64317600-64317622 GGCTATCCAATAGCATCGAGAGG - Exonic
1084013074 11:66363408-66363430 GGCTGCCAAAGAGCCTGGAGGGG + Exonic
1084172887 11:67409147-67409169 GGCTGGGCAAGTCCAAGGAGAGG - Intronic
1085417731 11:76330347-76330369 GGCTGTGGAAGGGCAGGGAGAGG + Intergenic
1085461342 11:76695741-76695763 AGCTGCGCAAGAGCAGGGAGGGG - Intergenic
1087602051 11:100329120-100329142 GGCTGTGTAAGAGCAGGTTGAGG + Intronic
1089335026 11:117717256-117717278 GGCAGTGCAGGTGCAGGGAGGGG - Intronic
1089943223 11:122440954-122440976 GGCTGAGGAAGAGCCAGGAGGGG - Intergenic
1090403247 11:126462221-126462243 GGCTGGGCAGGAGTGTGGAGAGG + Intronic
1091306543 11:134539877-134539899 GGCTGGGGAAGAGCATGCATGGG + Intergenic
1091356099 11:134938766-134938788 GTCTGTGCAAGAGCTTACAGGGG + Intergenic
1091384322 12:83137-83159 GGCTGTACAGGAGAAAGGAGAGG + Intronic
1091699555 12:2650880-2650902 GGCTGTACAAGACCCTGGAAGGG - Intronic
1092120741 12:6042119-6042141 GATTGCACAAGAGCATGGAGTGG + Intronic
1096745022 12:53721202-53721224 AGCTGAGCAAGAGCTAGGAGTGG - Intronic
1097185211 12:57193036-57193058 GGCTGGGCTGGAGCATGTAGGGG - Intronic
1098512411 12:71332411-71332433 GGCTGTGCAAAAGCAGGCTGAGG - Intronic
1102191789 12:110994307-110994329 GGCTGTGTGAGGACATGGAGAGG + Intergenic
1104921835 12:132294634-132294656 GGCAGGGCAGGAGCAAGGAGAGG + Intronic
1105507484 13:21023050-21023072 GGCTCTGCAGGTGCATGCAGTGG - Intronic
1105823142 13:24097687-24097709 GTCTGTGCAAGAGAAAAGAGAGG + Intronic
1106358322 13:29006085-29006107 GGCTGTGCAAGTTCCTGGAGAGG + Intronic
1106505147 13:30364678-30364700 GGCTTTGGGAGAGCATGCAGAGG - Intergenic
1107728228 13:43321428-43321450 GGCTGTAGAAGAGAATGTAGGGG - Intronic
1108472761 13:50783983-50784005 GGCTTTGCAAGAGCAAGGGTTGG - Intronic
1108989456 13:56636807-56636829 AGCTGTGCATGAGAATGGTGGGG + Intergenic
1109760074 13:66816548-66816570 GGATGTGCACAAGCCTGGAGAGG - Intronic
1111367143 13:87263324-87263346 GGGTGTGCCAGAGCATTGTGAGG - Intergenic
1113762645 13:112860337-112860359 GGCTGTACAGGAGGATGGGGAGG - Exonic
1114455467 14:22850806-22850828 TTCTGTGCAAGGGCATGGGGGGG + Intergenic
1117984679 14:61375539-61375561 GGCTGTACAACAGCATGGCTAGG + Intronic
1118003829 14:61547757-61547779 GGCTGCCCAAGCGCATGGTGGGG - Exonic
1120932899 14:89866550-89866572 TGGTGTGCAAGACCATGGGGAGG - Intronic
1121915937 14:97836953-97836975 GGCTGTCCATGAGCATGGATGGG + Intergenic
1122629596 14:103101513-103101535 GGCTGTGAAAGGCCATGGAGAGG - Intronic
1122806787 14:104263847-104263869 GTCTGTGCACAAGCATGGTGGGG + Intergenic
1123842877 15:24267166-24267188 GGATATGCAGGAGCATGCAGAGG - Intergenic
1123852435 15:24373153-24373175 GGATATGCAGGAGCATGCAGAGG - Intergenic
1123857914 15:24433192-24433214 GGATATGCAGGAGCATGCAGAGG - Intergenic
1123862547 15:24483737-24483759 GGATATGCAGGAGCATGCAGAGG - Intergenic
1124049313 15:26180248-26180270 GGATCTGCAAGCGCATGGAGTGG + Intergenic
1124375258 15:29125503-29125525 AGCTGGGCAAGACCATCGAGGGG + Intronic
1126370931 15:47946334-47946356 GCCTCTGCAAGGGCTTGGAGAGG - Intergenic
1127332335 15:57951413-57951435 GGGTGAGCAAGAGCATTGGGTGG + Intergenic
1129460599 15:75698362-75698384 GGCTCTGTGAGAGCATGGACGGG + Intronic
1129724261 15:77893673-77893695 GGCTGTGTGAGAGCATGGACGGG - Intergenic
1130138775 15:81204887-81204909 GGCAGAGCAAGAGCCTGGAGGGG + Intronic
1130856104 15:87841409-87841431 GGCTCAGCCAGAGGATGGAGAGG - Intergenic
1130888158 15:88111002-88111024 GGCTGTGCAAGAGCATGGAGGGG + Intronic
1132318633 15:100909038-100909060 GGGTTTGCACGCGCATGGAGGGG - Intronic
1132338576 15:101064264-101064286 GGCTGTGCAGGGCAATGGAGTGG - Intronic
1132981409 16:2740227-2740249 GGCTCTGCAGAAGCAGGGAGTGG - Intergenic
1135054422 16:19219020-19219042 GGCAGTGTAAGAGAATGGATGGG - Intronic
1136577725 16:31134303-31134325 GGCTGTGCCAGGCCCTGGAGGGG + Intronic
1136737588 16:32477565-32477587 GTCTGTGCAGAAGCTTGGAGGGG - Intergenic
1137520324 16:49189676-49189698 GGTTGTGCCAGAGCCTGAAGTGG - Intergenic
1137935385 16:52630265-52630287 GGATGTGGAAGAGCAGGTAGAGG + Intergenic
1139475892 16:67202388-67202410 GGCTGTCTCAGAGCCTGGAGTGG - Exonic
1139676450 16:68526986-68527008 GGCTGCGCAGGAGCCTGGGGCGG - Intergenic
1142371531 16:89685674-89685696 GGCTGTGAAAGAGATTGGAGAGG + Exonic
1203015483 16_KI270728v1_random:352012-352034 GTCTGTGCAGAAGCTTGGAGGGG + Intergenic
1203033818 16_KI270728v1_random:625170-625192 GTCTGTGCAGAAGCTTGGAGGGG + Intergenic
1144763477 17:17720595-17720617 GGCAGTGCAGCAGAATGGAGTGG - Intronic
1147733456 17:42618634-42618656 GGCTGGCCAAGAACAGGGAGGGG - Intergenic
1147987128 17:44313083-44313105 GGCTGAGCCAGGGCAGGGAGGGG - Exonic
1148020269 17:44548626-44548648 GGCTGAGCAAGACCAAGGTGTGG - Intergenic
1148112192 17:45151432-45151454 GGCTGTGCAAGGGGATGTACAGG - Exonic
1148691595 17:49530274-49530296 GGCTGTGTGTGTGCATGGAGGGG - Intergenic
1148836546 17:50468786-50468808 GGCTGAGCAAGAGCATTGGGCGG + Exonic
1148921461 17:51038686-51038708 GGATGTGCAGGTGCATGGAAAGG - Intronic
1149295876 17:55262466-55262488 GGCTGCTCAAGAGGAAGGAGAGG - Intergenic
1150281757 17:63932971-63932993 TGCTGTGAAAGAGTATGTAGGGG + Intergenic
1151282725 17:73088774-73088796 AGCTGTGCAAGAGGAGCGAGAGG + Exonic
1152343456 17:79737797-79737819 GGCGGTGAAAGAGGAAGGAGGGG + Intronic
1152794143 17:82298642-82298664 GGCTGAGCAAGGGCACAGAGGGG + Intergenic
1153170315 18:2308779-2308801 GGCTGTACCAGAGGATGGAGTGG - Intergenic
1158513848 18:58114813-58114835 GGCTTTGCAAACGCAGGGAGGGG - Intronic
1159549603 18:69880560-69880582 GGCTGTGCAAGAGAATGGGGAGG + Intronic
1159946910 18:74450729-74450751 AGCTGTGCATGAGCCTGGATGGG + Intronic
1160564400 18:79778128-79778150 GGCTGTGCACCTGCATGCAGAGG + Intergenic
1160585904 18:79913233-79913255 GGCTGTGGAAGAGCCTGGGCAGG - Intronic
1161011453 19:1961238-1961260 GGCTGTGGAGGGGCGTGGAGGGG + Intronic
1161014870 19:1978540-1978562 GGCTGCGCAGGGGCAGGGAGGGG + Intronic
1161441879 19:4296560-4296582 AGCTGTGAGAGAGCAGGGAGTGG - Intronic
1161494374 19:4579586-4579608 GGCTATGCAGGAGCTTTGAGAGG - Intergenic
1161761537 19:6176634-6176656 GGCTGCCCAAGAGGATGAAGTGG - Intronic
1162560542 19:11415958-11415980 GGCTGAGCGAGAGCAGGAAGAGG - Exonic
1162959106 19:14115889-14115911 GTCTGGGCATGAGCTTGGAGGGG - Intronic
1163008593 19:14411193-14411215 GGCCGTGTATCAGCATGGAGCGG - Intronic
1164547844 19:29183900-29183922 GGCTGTGCCAGGTCATGGTGTGG - Intergenic
1164831408 19:31324085-31324107 GGCTGTGCAAGTTGATGTAGGGG - Intronic
1165725515 19:38110105-38110127 GGCTGTGTGTGAGCAGGGAGTGG + Intronic
1165820240 19:38670255-38670277 GGGAGTGCAAGAGCATGGTGGGG + Intronic
1165895917 19:39140754-39140776 TGCTGTGCCGGAGCAGGGAGAGG - Intronic
1166749115 19:45156343-45156365 GGCCCGGCCAGAGCATGGAGAGG + Intronic
1168344550 19:55643881-55643903 GGCTGTTCTGGAGCTTGGAGGGG + Intronic
1168366661 19:55793687-55793709 AGCTGTGCAAAAGCAGGGAGGGG - Intronic
925211992 2:2057319-2057341 GGCTGTGAAAGGGCAGGGAGTGG - Intronic
925540284 2:4959352-4959374 GGGTGAGAAAGTGCATGGAGTGG - Intergenic
927995251 2:27480819-27480841 TGCTGTGGAAGTGCAGGGAGCGG + Intronic
930034257 2:47075774-47075796 GGCTGGGCTAAAGCCTGGAGAGG + Exonic
931103692 2:59031138-59031160 GGGTGTGCCAGAGAATGGGGAGG + Intergenic
932134337 2:69215083-69215105 GCCTGTGCAGCAGGATGGAGGGG - Intronic
932330177 2:70894300-70894322 GGCTGCCCAAGGGCAGGGAGAGG - Intergenic
932705841 2:74024445-74024467 GGCTGGGCAACAGCCTGAAGAGG - Intronic
933636570 2:84714446-84714468 GGCTGGGAAGGAGAATGGAGGGG + Intronic
934689564 2:96347865-96347887 TGCTGTGCACGGGCAGGGAGGGG + Intronic
937095207 2:119230855-119230877 GGCTGTGCAAGACCCTGGCAGGG + Exonic
937756167 2:125541605-125541627 GAGTGTGGAAGAGCCTGGAGTGG - Intergenic
938393647 2:130924763-130924785 GGCTGGGCAAGAGGAATGAGAGG + Intronic
938663749 2:133512853-133512875 AGCTGTGCAACTACATGGAGGGG - Intronic
940245748 2:151613851-151613873 GGCTGTACCAGAGCATGGCTGGG - Intronic
940584828 2:155633752-155633774 GTCTGTGCAAAATCATGGCGGGG - Intergenic
941080080 2:161050505-161050527 TCCTGTGCAAGAAGATGGAGAGG - Intergenic
943347902 2:186762110-186762132 GGCTGTGCATGAGAATGAATTGG - Exonic
944196131 2:197054936-197054958 GCCAGTGTAAGAGCATGGAATGG - Intronic
944210762 2:197204510-197204532 GGCTAGACAAGAGCATAGAGTGG + Intronic
945330164 2:208530052-208530074 GGCCGTGGAAGAGCATGGGCGGG - Intronic
948308889 2:236970374-236970396 GGCTGTGCAAAGGCCCGGAGAGG - Intergenic
948453563 2:238093466-238093488 GGCTGTACAAGGGCAGGGAATGG - Intronic
948686034 2:239670244-239670266 GGCTGTGCAGGAGCAGGTAAGGG + Intergenic
1169735553 20:8833877-8833899 GGATGGGCAAGAGCATGGAAGGG - Intronic
1171030506 20:21672347-21672369 GGCTGTGCAAGGGGAAGGAGAGG - Intergenic
1172192080 20:33068239-33068261 GAAGGTGGAAGAGCATGGAGTGG + Intronic
1173893864 20:46534663-46534685 GGCTCAGCCAGAGCAGGGAGAGG + Intergenic
1174421144 20:50399909-50399931 GGCTGGGCCAGGGCAGGGAGGGG - Intergenic
1175240602 20:57545426-57545448 GGCTGAGCAACAGAAAGGAGTGG + Intergenic
1175994434 20:62805749-62805771 GGCAGTGAGAGAGCACGGAGGGG + Intronic
1176023560 20:62974701-62974723 GGCTGTGCTCGTGCATGGAGTGG + Intergenic
1176100676 20:63363077-63363099 GGCTTGGGAAGAGCAAGGAGAGG - Intronic
1176217620 20:63955773-63955795 GGCTTTGCAAGAGCATGAAGTGG - Intronic
1177127708 21:17216955-17216977 GGCTGTGTGAGAGCAGGGTGAGG + Intergenic
1177820577 21:26026925-26026947 GGCTGTGCAAGTGTATGAACAGG + Intronic
1178257901 21:31071994-31072016 GGGTATGGAAGAGCATGGAATGG - Intergenic
1178861702 21:36295387-36295409 GGATGTGCAGAAGGATGGAGTGG - Intergenic
1179250893 21:39670350-39670372 GGCAGTGGAAGAGCAAGGGGCGG + Exonic
1182455091 22:30445227-30445249 CCCTGTGTAAGAGGATGGAGCGG + Intergenic
1182779702 22:32858047-32858069 GGCTGTGCAACTTCGTGGAGAGG + Exonic
1182878280 22:33711199-33711221 AGCTATGCAAGAGCAAGGGGTGG + Intronic
1183242465 22:36668198-36668220 GGCCGTGCATGATCATGGTGAGG - Intronic
1184697739 22:46149665-46149687 GACTCTGCCAGAGCAAGGAGAGG - Intergenic
1203299545 22_KI270736v1_random:67419-67441 GGCTCTGGAATAGAATGGAGTGG + Intergenic
949184493 3:1173833-1173855 TGGTGTGCAGGAGCATGTAGTGG - Intronic
949247729 3:1945040-1945062 TGCTGTGGAAAAGCATGGTGTGG - Intergenic
949892014 3:8740366-8740388 GGCTGTGCACGAGCTTTCAGTGG - Intronic
950408385 3:12818478-12818500 GGCTGGGCAAGAACCAGGAGGGG + Intronic
951926275 3:27912018-27912040 GACTGTGCAAGAGGAAGGACAGG - Intergenic
952269352 3:31817042-31817064 GGCTCAGCCAGAGCAGGGAGAGG - Intronic
952855770 3:37769652-37769674 GCATGTGCAAAAGCATAGAGGGG - Intronic
953534675 3:43768715-43768737 GGCTGTGAAGGAGCTTGGAGAGG + Intergenic
954455061 3:50593263-50593285 GGCTGTCCCAGAGTGTGGAGTGG - Intergenic
955000881 3:54926832-54926854 GGCTGTGCAGGAACTGGGAGAGG + Intronic
957392308 3:79592652-79592674 GGCTCTGCAAGGGCAGGGAGTGG - Intronic
960274561 3:115713422-115713444 GGCTGTGGAAGGGCCTGGACTGG + Intronic
960442829 3:117710289-117710311 GGCTGTGAAAGAGAAAAGAGAGG - Intergenic
960655681 3:120001412-120001434 AGCTGAGCGAGAGCATGAAGGGG - Intronic
961629533 3:128285783-128285805 GGCTGTGAAGGGGCAGGGAGTGG - Intronic
966807238 3:183817261-183817283 GGCTGGGCGAGAGCATGGCATGG - Exonic
967843894 3:194029459-194029481 GCCTGAGCAAGAGCAGGGAATGG + Intergenic
968492485 4:897583-897605 GGCTGTGAGAGGGCATGGATGGG + Intronic
968712430 4:2128581-2128603 GCCTGGGCAAGGGCCTGGAGTGG + Intronic
969239093 4:5887941-5887963 GGATGTGCCAGAGGATGGCGTGG - Intronic
969284784 4:6196352-6196374 GGCTGTGGATCAGCAGGGAGGGG - Intronic
969453574 4:7288459-7288481 GGATGTCCAAGATCAGGGAGAGG + Intronic
969470276 4:7383496-7383518 GGCTGGGCACCAGCAGGGAGGGG + Intronic
969538901 4:7773709-7773731 GGCTGTGCCAGAGAATGGGACGG - Intronic
969569380 4:7999774-7999796 GGCTGAGCCTGGGCATGGAGTGG - Intronic
969956546 4:10897042-10897064 GCCTGTGCAGGAGCATAAAGAGG + Intergenic
973094158 4:46176410-46176432 GGCTGTACAAAAGCATGGCTGGG - Intergenic
975313495 4:72928022-72928044 GGCTGTACAGTGGCATGGAGGGG + Intergenic
980174100 4:129324436-129324458 TGATGTCCAAGAGCATAGAGAGG - Intergenic
982351902 4:154425121-154425143 GGCTGTGCAACAGGATCTAGAGG + Intronic
984057549 4:174948689-174948711 GGCTGGGCAAGGGCATCTAGAGG + Intronic
984962733 4:185113282-185113304 GGCTGGGGAAGACCATGGAAGGG - Intergenic
985484718 5:141503-141525 GGGTGCCCAAGAGCAAGGAGAGG - Intronic
986191886 5:5504265-5504287 AGCTGTGGAAGAGAATGGAGTGG + Intergenic
989181455 5:38581424-38581446 GACTATGAAAGGGCATGGAGTGG - Intronic
990304729 5:54482770-54482792 GGGGGTGTGAGAGCATGGAGTGG + Intergenic
990606598 5:57416888-57416910 GCTTGTGCAAAAGAATGGAGAGG + Intergenic
990950740 5:61295994-61296016 GGTTCTACAAGAGCATGGAGGGG - Intergenic
991020458 5:61974501-61974523 GGCTAAGCAGGAACATGGAGTGG - Intergenic
993244237 5:85431633-85431655 GGGTGAGCCAGAGCAGGGAGAGG + Intergenic
993353799 5:86881535-86881557 GGCTGTGCAGGTGCAAGAAGGGG - Intergenic
993711939 5:91233998-91234020 GGCTGTGAAAGAGGAAAGAGGGG - Intergenic
993856255 5:93079304-93079326 GGCTGTGAAAGACCTTGGAAAGG - Intergenic
994153128 5:96473047-96473069 GTCTGTACAAGAGAAAGGAGAGG - Intergenic
994332602 5:98524869-98524891 CTTTGTGCAAGAGCATAGAGGGG - Intergenic
995622244 5:114039277-114039299 GTCTCTGCAAGAGAAGGGAGGGG + Intergenic
997368710 5:133342280-133342302 GGCTGGTCAACACCATGGAGGGG + Intronic
999370506 5:151052316-151052338 GGCTGAGCTAGAGGATGGTGGGG + Intronic
999510831 5:152250143-152250165 GGGTGTGCAAGGGCAGGGTGAGG - Intergenic
999829266 5:155303539-155303561 GGCTGTGCCAGGCTATGGAGAGG + Intergenic
1001656769 5:173356690-173356712 GGCTGTGCAAGTACAATGAGTGG - Intergenic
1002173210 5:177386583-177386605 GGGTGGGGAAGAGCTTGGAGGGG + Intronic
1002185744 5:177454142-177454164 GGCTGTGCAAGGGCAGGAGGCGG + Intronic
1003824959 6:9942480-9942502 GGCTGTGCAAGAGCTGGGGGCGG - Intronic
1004163925 6:13239042-13239064 AGCTGTGGAGGAGCAGGGAGTGG + Intronic
1006101410 6:31688397-31688419 GGCTGTGCTATAGCAAGGGGAGG - Intronic
1006132077 6:31875746-31875768 GGCTGTGGAAGAGCACGGACAGG + Intronic
1006944767 6:37777973-37777995 GGCTTTGCAGGCTCATGGAGAGG - Intergenic
1007165139 6:39823861-39823883 GGAGGTGGAAGAGGATGGAGAGG - Intronic
1007766228 6:44161857-44161879 CACGGTGCAAGGGCATGGAGTGG + Intronic
1007883889 6:45203701-45203723 GGCTCTGCATGAGGCTGGAGAGG - Intronic
1009878425 6:69535173-69535195 GGCTGTGCAAAAACATGGAGTGG - Intergenic
1009932534 6:70193421-70193443 GGCTGTGACAGAGGAAGGAGGGG - Intronic
1010621759 6:78085455-78085477 GCCTGTGCAGCAGCATGTAGGGG + Intergenic
1010973636 6:82289359-82289381 GGCAGGGGAAGAGCAAGGAGGGG + Intergenic
1013022544 6:106233832-106233854 GGTTGTACAGCAGCATGGAGGGG - Intronic
1013102384 6:106997948-106997970 GGCTGTGCCAGAGCAGGAAAGGG + Intergenic
1013172046 6:107645605-107645627 GGCTTCGCAAGAGCAGGGACCGG + Intronic
1014574720 6:123056053-123056075 GGCTGGGCCAGGGCAGGGAGAGG + Intronic
1015048968 6:128815879-128815901 GGCTGTGCAGGAGGAAGCAGAGG - Intergenic
1015875418 6:137817435-137817457 GGATGGGGAAGGGCATGGAGAGG + Intergenic
1016813999 6:148286978-148287000 GTCTGAGGAAGCGCATGGAGAGG - Intronic
1017922212 6:158882490-158882512 GGCTGTGTAAAAGCAGGAAGAGG + Intronic
1019232281 6:170577658-170577680 GACTGGGCAAGAGCATTGACTGG - Exonic
1020078861 7:5275776-5275798 GGCTCTGCAGGAACAGGGAGGGG - Intronic
1021884292 7:25123967-25123989 GGCTGTGTAAGAGTATCCAGGGG + Exonic
1024000650 7:45187317-45187339 AGATGTGCAAGAACATGGTGTGG + Intergenic
1024116358 7:46197441-46197463 GGGTAAGCAACAGCATGGAGCGG - Intergenic
1025200028 7:56956390-56956412 GGCTCTGCAGGAACAGGGAGGGG + Intergenic
1025671916 7:63620542-63620564 GGCTCTGCAGGAACAGGGAGGGG - Intergenic
1026806265 7:73431050-73431072 AGCTGTGCTGGAGCAGGGAGGGG - Intergenic
1030293035 7:107891156-107891178 GCCTGTGCATGCGCAGGGAGGGG + Exonic
1031595752 7:123647760-123647782 GTCTGTTCAATAGAATGGAGCGG + Intergenic
1032527668 7:132592012-132592034 GGGTGAACAAGAGCAAGGAGAGG + Intronic
1035226579 7:157437022-157437044 GGCTGTGACAGAGCCTGGTGGGG + Intergenic
1035271689 7:157723534-157723556 GGCTGTGGTAGAGAAAGGAGAGG - Intronic
1036019927 8:4833241-4833263 GGCTGTTCAGGAGCATGGCTGGG + Intronic
1036692410 8:10952105-10952127 GGCTTTGAAAAAGCCTGGAGAGG - Intronic
1037801093 8:22036474-22036496 GGCTCTGCAACAGGGTGGAGCGG - Exonic
1037828054 8:22171329-22171351 TGCTCTGCAAGAGCATGGTGTGG + Intronic
1038201952 8:25421196-25421218 GGCTGTGGAGTAGCCTGGAGTGG + Intronic
1039103858 8:33969726-33969748 GGCTGTGTAAGAGTATCCAGGGG + Intergenic
1039378766 8:37064742-37064764 GGCTGAGGAAGAGGATGAAGCGG - Intergenic
1042639019 8:70912122-70912144 GGCTGTGCACGAGTTTGGGGTGG + Intergenic
1042645551 8:70982487-70982509 GGCTGTGTGGGAGCAGGGAGAGG - Intergenic
1042711201 8:71719445-71719467 CACTGAGCAAGAGCATGGAGTGG - Intergenic
1044761012 8:95517603-95517625 GGCTGGGCAGGAGCAGGTAGTGG + Intergenic
1046102255 8:109628707-109628729 GGCTATGCAGGAGCCTGAAGTGG + Intronic
1048442121 8:134467732-134467754 GTCTGTGGAAGAGCATGCAATGG + Intergenic
1049613174 8:143565221-143565243 GGCAGTGCCAGAGCAAGGCGGGG + Intergenic
1049642111 8:143720486-143720508 AGCTGTGCCAGGGCGTGGAGAGG + Intronic
1050526257 9:6549361-6549383 GGGTGGGCAAGAGGAGGGAGTGG + Intronic
1050914728 9:11117842-11117864 GGCTGTACAGGAGCATGGCTGGG + Intergenic
1053027532 9:34742332-34742354 GGCTGTGGGATAGCATGGGGAGG + Intergenic
1053513458 9:38709149-38709171 GGCTGTGAAATAACATGGAGGGG - Intergenic
1054948542 9:70823452-70823474 GGCTGTGAAAGAGCATTCTGTGG - Intronic
1056935710 9:90913707-90913729 GGCAGTTCCCGAGCATGGAGGGG - Intergenic
1058424541 9:104864972-104864994 GGCTGTGCACGTGCATGGTGTGG + Intronic
1058802548 9:108558609-108558631 GGCTGTACAGGAGCATGGCTGGG - Intergenic
1058929895 9:109708925-109708947 GGCTGTGCAGGAGAATTCAGAGG + Intronic
1059247969 9:112864531-112864553 GGTTGGGCAAGGGCATGAAGCGG - Intronic
1059453815 9:114387419-114387441 AGCTGCGTAAGAGCAAGGAGAGG - Intronic
1059821218 9:117974323-117974345 CGCTGAGCAAGAGCTTGGAGAGG - Intergenic
1060911787 9:127357098-127357120 GGCTCTGCAGGAGCCTGGAGAGG + Intronic
1062621854 9:137426420-137426442 GGGTGGGCAAGAGGAGGGAGTGG - Intronic
1186254114 X:7701091-7701113 GGTTGTACAGCAGCATGGAGGGG + Intergenic
1187927705 X:24265038-24265060 GGCTGTACAAAAGCATGGCTAGG + Intergenic
1189446388 X:41085253-41085275 GGCTGGGCAGGAGCAGGGGGAGG + Intergenic
1192781919 X:74303256-74303278 GACTGTGCAAGTGCATAGGGTGG + Intergenic
1193491934 X:82161246-82161268 GGCTGTGCAGGAGCATGGCTGGG - Intergenic
1195630885 X:107054048-107054070 GGTTGTACAGCAGCATGGAGGGG + Intergenic
1195674828 X:107500006-107500028 GGCGGTGGAAGGGAATGGAGGGG + Intergenic
1198822316 X:140661737-140661759 GGATGTGCAAGATAATTGAGAGG - Intergenic
1199641350 X:149865482-149865504 GGCTGTGGAAGAGAAGGAAGAGG + Intergenic
1200016944 X:153172184-153172206 CTCTGTGCATGTGCATGGAGAGG + Intergenic
1200230830 X:154443169-154443191 GGCTGGGCAAGGGCTGGGAGGGG - Exonic
1200252229 X:154559757-154559779 GGCTGTGGAAGGGCTTGGTGTGG + Intronic
1200265539 X:154644659-154644681 GGCTGTGGAAGGGCTTGGTGTGG - Intergenic
1201116015 Y:10835956-10835978 GGGAGTGCAGTAGCATGGAGAGG - Intergenic
1201526520 Y:14941712-14941734 GGCTGTGTAAGAATATGCAGGGG + Intergenic
1201573086 Y:15434219-15434241 AGGAGTGCAAGAGCATGGTGTGG + Intergenic