ID: 1130893101

View in Genome Browser
Species Human (GRCh38)
Location 15:88150042-88150064
Sequence GCCTCCCTGAACAAAACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 142}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130893095_1130893101 -6 Left 1130893095 15:88150025-88150047 CCCTACCCCTCTCCAGTGCCTCC 0: 1
1: 0
2: 2
3: 56
4: 612
Right 1130893101 15:88150042-88150064 GCCTCCCTGAACAAAACCCATGG 0: 1
1: 0
2: 1
3: 16
4: 142
1130893096_1130893101 -7 Left 1130893096 15:88150026-88150048 CCTACCCCTCTCCAGTGCCTCCC 0: 1
1: 0
2: 6
3: 95
4: 832
Right 1130893101 15:88150042-88150064 GCCTCCCTGAACAAAACCCATGG 0: 1
1: 0
2: 1
3: 16
4: 142
1130893094_1130893101 3 Left 1130893094 15:88150016-88150038 CCTTTAGCTCCCTACCCCTCTCC 0: 1
1: 0
2: 6
3: 59
4: 674
Right 1130893101 15:88150042-88150064 GCCTCCCTGAACAAAACCCATGG 0: 1
1: 0
2: 1
3: 16
4: 142
1130893090_1130893101 13 Left 1130893090 15:88150006-88150028 CCGTCCCCTGCCTTTAGCTCCCT 0: 1
1: 0
2: 2
3: 75
4: 981
Right 1130893101 15:88150042-88150064 GCCTCCCTGAACAAAACCCATGG 0: 1
1: 0
2: 1
3: 16
4: 142
1130893092_1130893101 8 Left 1130893092 15:88150011-88150033 CCCTGCCTTTAGCTCCCTACCCC 0: 1
1: 0
2: 3
3: 15
4: 356
Right 1130893101 15:88150042-88150064 GCCTCCCTGAACAAAACCCATGG 0: 1
1: 0
2: 1
3: 16
4: 142
1130893093_1130893101 7 Left 1130893093 15:88150012-88150034 CCTGCCTTTAGCTCCCTACCCCT 0: 1
1: 0
2: 1
3: 26
4: 314
Right 1130893101 15:88150042-88150064 GCCTCCCTGAACAAAACCCATGG 0: 1
1: 0
2: 1
3: 16
4: 142
1130893091_1130893101 9 Left 1130893091 15:88150010-88150032 CCCCTGCCTTTAGCTCCCTACCC 0: 1
1: 0
2: 1
3: 35
4: 370
Right 1130893101 15:88150042-88150064 GCCTCCCTGAACAAAACCCATGG 0: 1
1: 0
2: 1
3: 16
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130893101 Original CRISPR GCCTCCCTGAACAAAACCCA TGG Intronic
903462556 1:23529936-23529958 GCCAATCTGAACAGAACCCAAGG + Intronic
903833711 1:26189630-26189652 CCCACCCTGAACAGAATCCAGGG - Exonic
906291644 1:44623305-44623327 GCCTCTCTGAACAAACCCTGTGG + Intronic
906349248 1:45043450-45043472 CCCACCCTGAAGAAGACCCAGGG - Intronic
907584573 1:55605674-55605696 ACCTCCCTGACAAAAAGCCAGGG - Intergenic
912698068 1:111856104-111856126 CCCTCCCTGATGAATACCCAAGG + Intronic
912777213 1:112513371-112513393 CCCTCCCCTAACAAATCCCATGG - Intronic
913312667 1:117517189-117517211 ACATCCCTGAACAAAACTCAAGG + Intronic
914894824 1:151660055-151660077 GCCTCTCTGAACAAAGCCCTTGG + Intronic
917074063 1:171185290-171185312 GCCTCCCAGCACACAACCAAGGG + Exonic
917393432 1:174564861-174564883 GCCACCCTGAACACATACCAAGG + Intronic
918387958 1:184029523-184029545 GGCTGCCTGGACAAAATCCAGGG + Intronic
920020188 1:202949826-202949848 GCCACCCTGAACAAAACCGTGGG - Intronic
920312261 1:205055529-205055551 GCCTCCCTGCAGAATGCCCAGGG + Intronic
922085372 1:222341827-222341849 GCATCTCTGAACACAGCCCATGG - Intergenic
923232780 1:232004569-232004591 GTCTCCTTCAACAAAACCCTTGG + Intronic
1063203762 10:3810824-3810846 GCCTTGCTGAACACAACCCCAGG + Intergenic
1069230557 10:66004295-66004317 GTCTACCTGAACCAATCCCAAGG + Intronic
1070618133 10:77985215-77985237 GCCTCCATGAACATCACCCTGGG - Exonic
1070675442 10:78408656-78408678 GCATCCCTGGGCAACACCCAAGG - Intergenic
1073332226 10:102677781-102677803 GAAGCCCTGAACAAAATCCAAGG + Intronic
1074746341 10:116536927-116536949 GCTTCCCTGAACAAAACCACTGG + Intergenic
1075216401 10:120539961-120539983 GCCTCCCTCCACAGATCCCAAGG + Intronic
1076321731 10:129587965-129587987 GCCTCCCAGAACAAAGCTAAAGG - Intronic
1080708473 11:34722063-34722085 GCCTCCATGGACAAAACCTCTGG + Intergenic
1089048865 11:115528460-115528482 GCCTCTGGGAATAAAACCCAGGG + Intergenic
1090089646 11:123683744-123683766 TCCTCCCTTAACCAAGCCCAAGG - Intergenic
1090936867 11:131350972-131350994 GCAACTCTGAATAAAACCCAAGG + Intergenic
1091203127 11:133797856-133797878 GACTCCCAGGACACAACCCAGGG + Intergenic
1092856074 12:12674956-12674978 GCCTCCCTGACCCCAGCCCAGGG - Intronic
1094828748 12:34290265-34290287 GCATCCCTGACCCACACCCACGG - Intergenic
1094856066 12:34403380-34403402 GCATCCCTGAATCAAGCCCACGG + Intergenic
1099957012 12:89360805-89360827 GTCTCCCTGGACTAAACTCAAGG + Intergenic
1101923089 12:108948776-108948798 ACCTCACTCAACAAAAACCATGG + Intronic
1105774589 13:23645880-23645902 TCCTCCCTCCACCAAACCCATGG + Intronic
1106893987 13:34277957-34277979 GCCTCTCTTAACCAAACCCAAGG + Intergenic
1106978952 13:35255338-35255360 GCATGCCTGAGCAAAACTCAGGG - Intronic
1107649925 13:42534867-42534889 CCATCCCTGAACCAATCCCAGGG - Intergenic
1107806172 13:44155962-44155984 GCTTCCCTAAACACCACCCAGGG + Intronic
1109843763 13:67956617-67956639 GTCTCACTGAACAAAAATCAAGG + Intergenic
1112689345 13:101872226-101872248 GACTCCCTGAATACAAACCATGG - Intronic
1117977144 14:61310058-61310080 CTCTCCCTCAACAAAACACATGG + Intronic
1118323237 14:64765407-64765429 GGCTCCCTGCACAGACCCCATGG + Intronic
1118331975 14:64822217-64822239 GCCTCCCTGAACTTGACCCAGGG - Intronic
1119267140 14:73269665-73269687 CCCTCCGTGAACAAGAACCAAGG - Intronic
1119434610 14:74589779-74589801 CCCTCCCTAAAAAAACCCCAAGG - Intronic
1122070810 14:99204306-99204328 GCCTCTCTGCACTAACCCCAGGG - Intronic
1122773688 14:104108002-104108024 CCCTCCCCGAAAAGAACCCAGGG - Intronic
1123403713 15:20008632-20008654 GCTTCCCTTAACCAAACACAGGG - Intergenic
1123513050 15:21015278-21015300 GCTTCCCTTAACCAAACACAGGG - Intergenic
1130625506 15:85510031-85510053 GACTGCCTGAGCAAAACGCAGGG - Intronic
1130893101 15:88150042-88150064 GCCTCCCTGAACAAAACCCATGG + Intronic
1138582696 16:57951973-57951995 GCCTCCCTGGCCAAACCCCAGGG - Intronic
1139661490 16:68424035-68424057 CCCTCCCTGCACAAAGCCCAAGG + Intronic
1140902367 16:79381064-79381086 GCCTCCCTGAACAGAATGAAGGG + Intergenic
1141668775 16:85480570-85480592 GCCACCCAGAACAAATCACATGG + Intergenic
1141943136 16:87291627-87291649 ACCCCTTTGAACAAAACCCATGG + Intronic
1144082489 17:11776978-11777000 GTAACCCTCAACAAAACCCAAGG - Intronic
1144219400 17:13086401-13086423 CATTCCCTGCACAAAACCCAGGG + Intergenic
1147169227 17:38608503-38608525 AGCTCCCTGAATAGAACCCAAGG + Intergenic
1149324474 17:55516008-55516030 GGCTCCATGAAGAAAACGCATGG + Intergenic
1150982547 17:70158463-70158485 TCCTCTCTGTACAAAAACCAGGG - Intergenic
1151559065 17:74861225-74861247 GCCGCCCGGGTCAAAACCCAAGG + Intronic
1151926005 17:77197326-77197348 GCCTCCCTGAATAAAGAACAAGG - Intronic
1152549377 17:81021672-81021694 GCCTCCCTGGACCCAACCCAGGG - Intergenic
1152737673 17:82005295-82005317 GCCTCCGAGACCAAACCCCAGGG - Intronic
1153377371 18:4395945-4395967 GTCTACCTGAAGAAGACCCAGGG + Intronic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1160411652 18:78679142-78679164 GACTCCCTGAAGAAGACCTAAGG + Intergenic
1161265499 19:3361649-3361671 GCCTCCCCCAACAACACTCAAGG + Intronic
1163387404 19:17008316-17008338 GGCTCCCAGATCCAAACCCATGG + Intronic
1163417235 19:17194214-17194236 GCCTCCTAGAAAAAGACCCAAGG + Intronic
1165435361 19:35792140-35792162 GCTTACCTGACCAAACCCCAAGG + Intergenic
1168259970 19:55187800-55187822 GCCTGCCTGAAGAAGTCCCATGG - Intronic
925026010 2:607836-607858 GCCTCCCTGCACAGGAGCCACGG - Intergenic
925532793 2:4883551-4883573 ACCTCACTGAGCAAACCCCAGGG - Intergenic
926630065 2:15128083-15128105 GCATCCCTGGAGGAAACCCAAGG + Intergenic
927562509 2:24084040-24084062 GCTTCCCAGACCTAAACCCAGGG - Intronic
928416412 2:31095934-31095956 GCCTCCCTGAGCTAAAATCAAGG + Intronic
930499399 2:52193067-52193089 GCCTTTCTGAACAAAACCAATGG + Intergenic
931407682 2:61995888-61995910 GCCACCTGGAACCAAACCCAAGG - Intronic
933407813 2:81883973-81883995 TCCTCTGTGAACAAAACTCATGG + Intergenic
934522764 2:95030346-95030368 CCCTCCTCCAACAAAACCCAGGG + Intronic
934718560 2:96557364-96557386 GCCTCCCTGACGACTACCCAGGG - Intergenic
938159562 2:128973182-128973204 CCCTCCCTGGACATAACCAAGGG + Intergenic
938208896 2:129447943-129447965 GCATCCCTGAACAAAGCTCAAGG + Intergenic
939971681 2:148669354-148669376 GCATCCCAGAACAAAGCTCAAGG - Intronic
941986589 2:171517059-171517081 GCCTCCCAGAGCACAAGCCAAGG + Intergenic
942534983 2:176953733-176953755 TCCTGCTTGATCAAAACCCAAGG + Intergenic
944894131 2:204146638-204146660 GCCTCCCAGAACAACTCTCAGGG + Intergenic
1174709969 20:52694140-52694162 TCATCTCTGAACAAAACACAGGG + Intergenic
1178031809 21:28536274-28536296 GCCTCCCTAAATAAATCCAAAGG + Intergenic
1179423797 21:41256672-41256694 GCCTTTCTGAACCAAACCAATGG + Intronic
1180864277 22:19106926-19106948 GGCTCACTGCACAAAGCCCAGGG + Intronic
1181025945 22:20127755-20127777 GCCTCCCTGCTCCAAAGCCAAGG - Intergenic
1184530972 22:45055505-45055527 GGCTTCCTGAGCAAATCCCAGGG + Intergenic
1185162274 22:49237109-49237131 GCCTCCCTGCACAAAAAGCGAGG + Intergenic
950372636 3:12544034-12544056 GCCTCCCTGAGCAAGGCCCAGGG + Intronic
953179515 3:40582916-40582938 TCCTCCCAGAACAAACCCAAAGG + Intergenic
953768619 3:45762312-45762334 GCCTGCCTGATCAGAACCCTGGG + Intronic
954798524 3:53173783-53173805 GCCTCCATTTCCAAAACCCAGGG - Intronic
959889331 3:111536122-111536144 TCTTCCCTGAGCAAAACCAAAGG + Intronic
964662273 3:159133582-159133604 GCCTCCAAGAACAAAATACATGG + Intronic
966228148 3:177620270-177620292 GCCTCCCAGAACATAAACGACGG - Intergenic
967110183 3:186286147-186286169 GCACCCCTGAAAAAAACACAAGG - Intronic
969638037 4:8380757-8380779 GCCTCCCTGCACAACACTCATGG + Intronic
971062848 4:22991969-22991991 GGCTCCCTGAACAAAACTCAAGG - Intergenic
972299053 4:37767849-37767871 GACTCCCACAACAAAACCAAGGG + Intergenic
973828065 4:54729258-54729280 GCCTCCCATAAAAATACCCAAGG - Intronic
974169808 4:58251661-58251683 TCATCTCTGAAGAAAACCCAGGG - Intergenic
975661166 4:76689898-76689920 GCCTCTCTGATAAAAAGCCAAGG - Intronic
976142584 4:82007866-82007888 TCCTTCCAGGACAAAACCCATGG + Intronic
980379056 4:131986736-131986758 ACTTCCATCAACAAAACCCATGG + Intergenic
982122026 4:152151902-152151924 GCTTGCCTGAACATATCCCATGG + Intergenic
983369415 4:166839886-166839908 GCCCCTCTTTACAAAACCCAGGG - Intronic
986400895 5:7378647-7378669 GGCTCCCAAAACAAAACCCCTGG + Intergenic
987620810 5:20336901-20336923 GAGTGCCTGAGCAAAACCCATGG - Intronic
988708393 5:33748288-33748310 GCTTCCCTGAATTAAATCCAGGG - Intronic
988787088 5:34575068-34575090 GCCTCCCTTTAGAAAACCCCAGG - Intergenic
996734767 5:126748451-126748473 GGCTCCAAGCACAAAACCCAGGG + Intergenic
997286335 5:132681378-132681400 GCCTCCATCAGCCAAACCCAGGG - Intronic
997973151 5:138420837-138420859 GCCTCCAACAACAAAACCGAAGG + Exonic
998850324 5:146345320-146345342 GCCTCCCTGAACTCAACGCAGGG + Intergenic
1002200185 5:177523781-177523803 GCCTGCCTGCTGAAAACCCACGG - Intronic
1008132445 6:47734124-47734146 GCCTCACTGGACTAAAACCAAGG - Intergenic
1008503709 6:52208790-52208812 CCCACCTTGAACAAATCCCAAGG + Intergenic
1009697309 6:67123657-67123679 GCCACCCTGGATAAAACACATGG + Intergenic
1012601085 6:101097768-101097790 GCCTCCTGGTACAAAATCCAGGG - Intergenic
1012767264 6:103383902-103383924 GCCTCCCAGAACAGAGCTCAAGG + Intergenic
1013364821 6:109429101-109429123 TTCTTCCTGAATAAAACCCAGGG - Intronic
1017929748 6:158941456-158941478 GCCTTCCTGTAAATAACCCAAGG + Intergenic
1022012571 7:26321635-26321657 TCCTGCCTGAACAAAACCTTGGG - Intronic
1024457911 7:49630068-49630090 ACCATCCTGAAGAAAACCCACGG + Intergenic
1026393777 7:69929951-69929973 GCATCCCAGAACAAAGCTCAAGG - Intronic
1029550541 7:101234984-101235006 GCCTCCCTGACCTCTACCCACGG + Intronic
1034325586 7:150228668-150228690 GTCTGCCTGAACCAAAGCCAGGG - Intergenic
1034767614 7:153740592-153740614 GTCTGCCTGAACCAAAGCCAGGG + Intergenic
1037066037 8:14578421-14578443 GCAGCCATGAACCAAACCCAGGG - Intronic
1038673035 8:29597562-29597584 GCCTCCCTTAACAGATACCAGGG - Intergenic
1041545191 8:59034630-59034652 CCCTCACTCAAGAAAACCCAAGG + Intronic
1044395947 8:91712670-91712692 GACTAACTGAACAAAAGCCATGG + Intergenic
1045224307 8:100229592-100229614 ACCTCACTGATCAAAACCCCAGG - Intronic
1047054114 8:121145354-121145376 GCCTCCCTGGGAAAAACTCAGGG - Intergenic
1048390959 8:133963986-133964008 GCCTCCCTGAGAAGAAGCCATGG - Intergenic
1049298087 8:141854557-141854579 GCCTCCCTGTTCCAAAGCCACGG - Intergenic
1049767405 8:144361315-144361337 GCTTCCCTGAACTAGAGCCATGG + Intergenic
1053303108 9:36965567-36965589 GCCTCCCTGCACAGCTCCCATGG - Intronic
1053490523 9:38497614-38497636 GACTGCCTAAACAAAACTCAAGG - Intergenic
1056158070 9:83859500-83859522 CCCTCCCTCAAAAAAATCCATGG - Intronic
1056352480 9:85764557-85764579 CCCTCCCTCAAAAAAATCCATGG + Intergenic
1057159072 9:92872719-92872741 GTCTCACTGAACTAAAACCAAGG - Intronic
1057670839 9:97086869-97086891 GACTGCCTGAACAAAACTCAAGG - Intergenic
1059710340 9:116862219-116862241 GGCTCTCTGAACAAGACCCAAGG - Intronic
1061509965 9:131054376-131054398 GCCTCCCAAAACATTACCCATGG - Intronic
1187199386 X:17120288-17120310 GCCTCCCTGAGCCCAACCCCTGG - Intronic
1190284202 X:48951310-48951332 GGCTCCATGGACAAAACACAGGG + Intronic
1192740273 X:73885551-73885573 GCATCCCTGAAACAAATCCACGG - Intergenic
1193998561 X:88398185-88398207 GCTTGCCTCAAGAAAACCCAGGG + Intergenic
1194268002 X:91778964-91778986 GCTTTCCTGAGCAAAACCCTGGG - Intergenic
1194508312 X:94760843-94760865 GCCACAGTGAAGAAAACCCAAGG - Intergenic