ID: 1130894221

View in Genome Browser
Species Human (GRCh38)
Location 15:88157998-88158020
Sequence CCGGGCCCGTGAGGTGCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130894221 Original CRISPR CCGGGCCCGTGAGGTGCCAA AGG (reversed) Intronic
900376588 1:2357527-2357549 CCGGGGCCCAGAGCTGCCAAGGG - Exonic
901271288 1:7953982-7954004 CTGGGCCCAGCAGGTGCCAAGGG + Intergenic
902480259 1:16707862-16707884 CCGGGCCCGGGCGGTGCGGAGGG - Intergenic
905168949 1:36098785-36098807 CAGGGCCCATCAGGGGCCAAAGG - Exonic
905182271 1:36174846-36174868 CCGGGCCCGGCAGGAGCCAGTGG - Intronic
906116317 1:43359393-43359415 CCTGGTCAGTGAGGTGCCAAAGG + Exonic
906509957 1:46405314-46405336 CAGGGCCCGTGGGCAGCCAAGGG - Intronic
912729295 1:112087811-112087833 CCTGGCCCCTGAGGAGGCAAGGG - Intergenic
914675579 1:149905050-149905072 CAGGGCCAGAGAGCTGCCAAGGG + Exonic
915283803 1:154840387-154840409 CGGGGACTGTGAGGTGACAAAGG - Intronic
1070918554 10:80169918-80169940 CCGGTGCCCTGAGGTGCCAAGGG - Intronic
1074941839 10:118244043-118244065 CTGAGCCCGTGAGGTACCAATGG + Intergenic
1078771779 11:14358651-14358673 CCGGGCCCGCGAGGCGCCTCTGG + Intronic
1080596780 11:33780105-33780127 GCGGGACAGTGAGGTGCCCAGGG - Intergenic
1081658405 11:44873174-44873196 CAGGGCCCCTGTGCTGCCAAGGG - Intronic
1085010846 11:73141211-73141233 CCGGGCCCGGGAGGTGCGTGGGG - Intronic
1089873845 11:121701189-121701211 CAGGGTCCATGAGGTGCCACTGG - Intergenic
1089873854 11:121701227-121701249 CAGGGTCCGTGAGGCGCCATTGG - Intergenic
1094499141 12:31007422-31007444 CCAGGTCAGTGAGGAGCCAAGGG - Intergenic
1104686196 12:130786707-130786729 CCATGTCCGTGAGGTGGCAAAGG + Intergenic
1104903961 12:132203754-132203776 AGGGGCCCGTGAGAGGCCAAGGG + Intronic
1105278374 13:18949148-18949170 CAGGGCCCGGGAGGTGGCATTGG - Intergenic
1113656475 13:112071053-112071075 CCGGGACCTTGAGGGTCCAATGG + Intergenic
1123040353 14:105487792-105487814 CCGGGCCTCTGCGGTGGCAAGGG - Intronic
1129780232 15:78264920-78264942 CCGGGCTCCCGAGGGGCCAAGGG + Intronic
1130894221 15:88157998-88158020 CCGGGCCCGTGAGGTGCCAAAGG - Intronic
1132079821 15:98854423-98854445 CTGGGCTCATGAGGTGCCTAGGG + Intronic
1132977788 16:2719286-2719308 CCGGGCCACTGAGGGGCCACTGG + Intronic
1137782190 16:51107146-51107168 CTGGCCCCGTGAGGTGCTAAGGG + Intergenic
1142429600 16:90019150-90019172 CCGCGCCCGGGAGGTGCCCCTGG + Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1149833620 17:59893177-59893199 CCGGGCCCATGAGGCGACGAAGG + Exonic
1151604838 17:75129789-75129811 CCGGGGCCATGGGGTGGCAAGGG - Exonic
1153051353 18:905708-905730 CCGGGACCCTGAGCTGCCTAGGG - Intronic
1160528247 18:79549479-79549501 CCGGGCCCGAGAGACGCCACCGG - Intergenic
1160795071 19:941419-941441 GCGGGCGCGTGAGGTGCCGCTGG - Intronic
1161265425 19:3361324-3361346 ACGGGCCCGGGAGGTGGCTAAGG + Intronic
1161964504 19:7540820-7540842 CCAGTCCCGTGAGGGGCCATCGG - Intronic
1162053703 19:8050534-8050556 CCCGGCCCGTGGGCTGCCACTGG + Intronic
1162057842 19:8075366-8075388 CCTGGCCCATGTGGTGCCCACGG - Exonic
1163018343 19:14470212-14470234 CCTGGCCCCTGAGGTGCTGACGG + Exonic
1167578470 19:50328898-50328920 CCGGGCCCGCGGGGTGCCGGGGG + Exonic
1202714298 1_KI270714v1_random:33772-33794 CCGGGCCCGGGCGGTGCGGAGGG - Intergenic
925390782 2:3492489-3492511 CATGGCCCGTGAAGTGCCCACGG + Intergenic
927119633 2:19944858-19944880 TTGGGCCCCTGAGCTGCCAAAGG - Intronic
927490191 2:23516239-23516261 CCGGGCCCAGCAGGTGCCCATGG - Intronic
927893840 2:26768982-26769004 CCTGGCTCCTGAGGTGACAATGG - Intronic
928964846 2:36966396-36966418 CCGGGCGCCGGCGGTGCCAAGGG - Exonic
938308290 2:130268899-130268921 CCGGGTCCTCGAGGTGCCACTGG + Intergenic
938447039 2:131387937-131387959 CCGGGTCCTCGAGGTGCCACTGG - Intergenic
944581894 2:201138739-201138761 CCAGGCCAGTGAGGTGCAGAAGG - Intronic
948487397 2:238289387-238289409 CCGGGCCTCTGAGGTGCCTGTGG + Intronic
1170850027 20:19996441-19996463 CCAGGCCTGGGAGGGGCCAAGGG - Intronic
1173691800 20:44966596-44966618 CCGCGCCGGTGAGGGGCCACTGG + Exonic
1179950182 21:44704815-44704837 CCGGGGCCGTGACGTGACACTGG - Intronic
1180225147 21:46387699-46387721 TGGGGACCGTGAGGTGACAACGG - Intronic
1184360873 22:44017847-44017869 GGGGGTCCGTGGGGTGCCAAGGG + Intronic
1185110905 22:48899650-48899672 CGGGGCCTGAGAGGTGCCATGGG - Intergenic
1185376002 22:50482825-50482847 CCGGTCCCATGAGTTGCCACAGG - Exonic
954132996 3:48569599-48569621 CCAGGCCCACGGGGTGCCAAGGG - Exonic
964404882 3:156338841-156338863 ACAGCCCCATGAGGTGCCAAGGG - Intronic
973789719 4:54366781-54366803 CCTGGCCTTTGAGGTGACAATGG - Intergenic
985932152 5:3067165-3067187 CAGAGCCCATGGGGTGCCAAGGG + Intergenic
986168681 5:5297711-5297733 CAGGGACTGTGAGGAGCCAAAGG - Intronic
987656885 5:20818447-20818469 CCAGGCCCGTCAGGTGGTAAGGG + Intergenic
988766667 5:34385503-34385525 CCAGGCCCGTCAGGTGGTAAGGG - Intergenic
999251970 5:150188199-150188221 CTGGGACTGTGAGGTGCAAATGG - Intergenic
1002314412 5:178333895-178333917 CAGGGCCCGTGAGGTAGCCAAGG + Intronic
1019642296 7:2110361-2110383 CCGGGACCTCGAGGCGCCAAGGG - Intronic
1022678871 7:32525808-32525830 CAGGCCCAGTGAGATGCCAAAGG - Intronic
1024033030 7:45481152-45481174 CTGGGCCCTTGATGTGCAAAAGG + Intergenic
1026896333 7:74012110-74012132 CCTGGCCCGTGGGCTCCCAATGG + Intergenic
1035258105 7:157644891-157644913 TCGGGCCCGTGTGGTTCCCACGG - Intronic
1036462236 8:8963538-8963560 CCGGGGCCGGGAGCTGCCAAAGG - Intergenic
1041686689 8:60651760-60651782 CCGGCCCCGTGCGGCGCCACCGG + Intergenic
1048439904 8:134452203-134452225 CAGGGCCAGTGAGGTGGCAGGGG + Intergenic
1052940063 9:34126154-34126176 CCAGGGCGGTGAGGAGCCAAAGG - Intronic
1053131880 9:35619999-35620021 CAGGGCCCCTGAGGTCCCCAGGG - Intronic
1059769506 9:117413401-117413423 CAGCGCCCGTGAGGCGCCAGGGG - Intronic
1061919732 9:133776222-133776244 CCTGGCCTGGGAGGTGCCCAAGG + Intronic
1192543970 X:71997388-71997410 CCTGGCCCAAGATGTGCCAAAGG + Intergenic
1200017482 X:153178331-153178353 CCAGTCCCATGAGGTGGCAATGG - Intergenic