ID: 1130894405

View in Genome Browser
Species Human (GRCh38)
Location 15:88159071-88159093
Sequence CAGGGTCCCCAAAGGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 227}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130894388_1130894405 29 Left 1130894388 15:88159019-88159041 CCCGGGCTGAGAGAGAGCTGCCC 0: 1
1: 0
2: 2
3: 27
4: 356
Right 1130894405 15:88159071-88159093 CAGGGTCCCCAAAGGCTGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 227
1130894389_1130894405 28 Left 1130894389 15:88159020-88159042 CCGGGCTGAGAGAGAGCTGCCCA 0: 1
1: 0
2: 0
3: 31
4: 302
Right 1130894405 15:88159071-88159093 CAGGGTCCCCAAAGGCTGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 227
1130894397_1130894405 8 Left 1130894397 15:88159040-88159062 CCAGGGCGGGCACTGTCAGGGCT 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1130894405 15:88159071-88159093 CAGGGTCCCCAAAGGCTGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 227
1130894387_1130894405 30 Left 1130894387 15:88159018-88159040 CCCCGGGCTGAGAGAGAGCTGCC 0: 1
1: 0
2: 1
3: 9
4: 209
Right 1130894405 15:88159071-88159093 CAGGGTCCCCAAAGGCTGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 227
1130894396_1130894405 9 Left 1130894396 15:88159039-88159061 CCCAGGGCGGGCACTGTCAGGGC 0: 1
1: 0
2: 1
3: 8
4: 171
Right 1130894405 15:88159071-88159093 CAGGGTCCCCAAAGGCTGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130894405 Original CRISPR CAGGGTCCCCAAAGGCTGGT GGG Intronic
900125423 1:1066996-1067018 CAGGGTCCCCAAGGGAGGGGTGG + Intergenic
900332756 1:2144410-2144432 CAGGGTCACCAAGGTCTGCTTGG - Intronic
900491298 1:2950430-2950452 CAGTTTCCCCAAATGCAGGTGGG + Intergenic
900546946 1:3234599-3234621 CAGGGCCCCCGCAGGCTGGATGG + Intronic
905213539 1:36390939-36390961 CTGGCTTCCCACAGGCTGGTGGG + Intergenic
905884456 1:41484354-41484376 CAGGCTCCCCACGGGCTGCTGGG - Intronic
911021766 1:93396511-93396533 AAAAGTCCCCCAAGGCTGGTAGG + Intergenic
911381286 1:97118255-97118277 CAGGGTGCCCAGAGTCTGGGTGG - Intronic
914979157 1:152397554-152397576 CAAGGTCCCCAAGGGCTGAGGGG + Intergenic
919519812 1:198573596-198573618 CAGGGTCCTGAAAGGCTGTTAGG - Intergenic
920183337 1:204146088-204146110 CAGGGTCCCCAAAGGCACATGGG + Intronic
923324264 1:232867026-232867048 CAGGGTCCTGACAGGCTGGGAGG + Intergenic
923413286 1:233730984-233731006 AAGGGTGCCCAAAGGCAGGCTGG - Intergenic
924801825 1:247333370-247333392 AGGGGTCATCAAAGGCTGGTAGG + Intergenic
1063034042 10:2267623-2267645 CTGGGTCCCCACAAGCTGGAAGG - Intergenic
1063222797 10:3986374-3986396 CTGGATCCCCAAAATCTGGTAGG - Intergenic
1063372673 10:5531996-5532018 CAAGGTCCACAAGGGCTGCTGGG + Intergenic
1065442017 10:25762616-25762638 GGAGGTCCCCAAATGCTGGTGGG + Intergenic
1066052463 10:31648263-31648285 CAGGGGCTCCAATGCCTGGTTGG - Intergenic
1068631156 10:59298938-59298960 TAGGGTTACCAGAGGCTGGTGGG + Intronic
1069623822 10:69854537-69854559 CAGGGTCTCAAAAGACTGGAGGG - Intronic
1069934991 10:71909289-71909311 CAGTGTCCCCAAAGGCTCAGAGG + Intergenic
1070510555 10:77156956-77156978 CAGTCTCCCCAAAGGCTAGGAGG - Intronic
1070573122 10:77656602-77656624 CAGCCTCCCCAATGGCTGGCAGG + Intergenic
1072659081 10:97351492-97351514 CAGGGCCCCAACAGGCTGCTAGG + Intergenic
1073043118 10:100620838-100620860 CAGGGTACCCCAAGTCTGGACGG - Intergenic
1074262090 10:111864097-111864119 CAGGGTGCCCAGGTGCTGGTAGG - Intergenic
1074312167 10:112331338-112331360 GGAGGTCCCCAAATGCTGGTGGG - Intergenic
1076057303 10:127386244-127386266 GTGGGCTCCCAAAGGCTGGTTGG + Intronic
1078753213 11:14184816-14184838 CAGGGATCCCAAAGGCTGGAGGG - Intronic
1082087690 11:48063555-48063577 CAGTGTCCCAACAGGCTGCTGGG + Intronic
1082260010 11:50071535-50071557 GAGGGCCCACAAAGGCTGGCAGG + Intergenic
1083170741 11:60922730-60922752 CAGGGTCCCCTGAGGCCTGTGGG + Exonic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085156748 11:74302536-74302558 CAAGGTCCTCAAAGGCTGGAAGG + Exonic
1085287943 11:75376272-75376294 CAGGGTCCCTAAGCTCTGGTTGG + Intergenic
1085387564 11:76165666-76165688 CAGGGTCCCCGAGGGCTGTCTGG + Intergenic
1087098173 11:94339650-94339672 GAAGGTTCCCAAATGCTGGTAGG + Intergenic
1087886453 11:103488488-103488510 CAAGGTACCCAGATGCTGGTAGG - Intergenic
1088806652 11:113358846-113358868 CTTGGTCCCCAAAGGCTCTTGGG - Intronic
1090062451 11:123475889-123475911 CATGGTCTCCGAAGACTGGTAGG + Intergenic
1091800386 12:3321233-3321255 CAGGCCCCCTAAGGGCTGGTCGG + Intergenic
1092386379 12:8038647-8038669 CAGGGTCTAGAAAGGCTGGCAGG - Intronic
1092815096 12:12305740-12305762 GAAGGTCCCTAAACGCTGGTGGG + Intergenic
1093350620 12:18095617-18095639 CAGGATCCCCAAATGGTGGAGGG - Intronic
1094617462 12:32048784-32048806 AAGGGTCCCCAAACCCTGTTAGG + Intergenic
1097034834 12:56116899-56116921 AAGGGTGCCCAAGAGCTGGTGGG + Intronic
1100031994 12:90203810-90203832 GAGGGTTGGCAAAGGCTGGTAGG - Intergenic
1100370618 12:93965960-93965982 CAGGGCCCCCAAAGTCCTGTGGG + Intergenic
1100715306 12:97299456-97299478 GAGAGTCCCCAAAGGCTGGATGG - Intergenic
1102201861 12:111062962-111062984 CAGGGTCCCATGAGGCTTGTAGG + Intronic
1103133232 12:118486488-118486510 CCGTGTCCCCAAAGGCAAGTTGG + Intergenic
1103903723 12:124316634-124316656 GAGTGTCCCCAGAGGCTGCTGGG + Intergenic
1104012691 12:124943234-124943256 CTGGGTCCCCAAAACATGGTAGG - Intergenic
1105701776 13:22939978-22940000 CAGGGTCCCCAGAGGAAGGCGGG + Intergenic
1108520879 13:51246139-51246161 CAGACTGCCCCAAGGCTGGTGGG - Intronic
1110195828 13:72787525-72787547 CAGGGTCCCCAAAAGCCTGATGG + Intronic
1111986940 13:95075695-95075717 CAGGGTCCCCTCAGGCTATTGGG - Intronic
1112361092 13:98719261-98719283 CAGGAACCCCAAAGGCCAGTGGG + Exonic
1114476144 14:22996299-22996321 CAGGTTCCCCTAAGCCTGGCTGG - Intronic
1118735134 14:68695697-68695719 CAGGGTGACCAGAGGCTTGTGGG - Intronic
1120272492 14:82331250-82331272 CAGTGAGCCCAAAGGTTGGTAGG - Intergenic
1120953667 14:90063201-90063223 CAGGGGCCCCATGAGCTGGTTGG + Intronic
1121262930 14:92579754-92579776 CAGGGGCCTCCAAGTCTGGTTGG + Intronic
1121308977 14:92924539-92924561 TAGGCTCCCCAGGGGCTGGTGGG + Intronic
1121889230 14:97573657-97573679 CAAGGTCCCCAGATTCTGGTCGG + Intergenic
1122038509 14:98965290-98965312 CAGGCTCACCACAGGCAGGTGGG + Intergenic
1122115134 14:99523725-99523747 CAGGGCCCCCAAAGTGTGATGGG + Intronic
1122136929 14:99638713-99638735 CAGGGCCCACAAAGGCTGCCTGG - Intergenic
1122463361 14:101914663-101914685 CCGGGTCCCCAACGCCTGCTGGG - Intronic
1122843167 14:104476605-104476627 CAGGGTGCCCAGAGGAAGGTGGG + Intronic
1124029336 15:25995235-25995257 CAAGGTCCCCACAGGCTTGAGGG - Intergenic
1125692866 15:41610897-41610919 GAGAGTCACCAAAGGTTGGTTGG + Intergenic
1129298098 15:74610792-74610814 AAGGGTCCCCCAGGCCTGGTAGG + Intronic
1130894405 15:88159071-88159093 CAGGGTCCCCAAAGGCTGGTGGG + Intronic
1132808752 16:1787791-1787813 GAGGGCCCCCAGGGGCTGGTAGG - Exonic
1132991200 16:2795712-2795734 CAGCCTCCCCAAAGGCTTGGAGG + Intergenic
1133212276 16:4270403-4270425 CAGGGTCATCTCAGGCTGGTGGG - Intronic
1133548290 16:6829073-6829095 GGAGGTCCCCAAATGCTGGTGGG - Intronic
1134216648 16:12321684-12321706 CTGGGTATCCACAGGCTGGTTGG - Intronic
1135326721 16:21530856-21530878 CTGGGGCCCCATAGGCTGGGTGG - Intergenic
1135918420 16:26626304-26626326 CAGGGTACTCAGAGGCTGTTAGG + Intergenic
1136487941 16:30585330-30585352 CGGTGTCCCCAGAGGCTAGTGGG - Intronic
1137605831 16:49786293-49786315 CAGGGTCCCCACTGGCAGGGTGG + Intronic
1138030886 16:53558648-53558670 CCAGGTCTCCAAAGGCTGCTCGG - Intergenic
1139372846 16:66479422-66479444 CAGGCACCCCCAAGGCTGGTTGG + Intronic
1140551359 16:75869692-75869714 CAGGGTCACCCAGGGCAGGTTGG + Intergenic
1142022311 16:87791540-87791562 GAGGCTCCCCAGAGGCTGGTGGG - Intergenic
1142039772 16:87885606-87885628 CTGGGGCCCCACAGGCTGGGTGG - Exonic
1142129914 16:88427777-88427799 CAGGCTCCCTCAAGGCTGGCGGG + Exonic
1142228619 16:88889104-88889126 CTGTGTCCCCAAAGACTGGGAGG + Intronic
1143801890 17:9390055-9390077 CTGTGTCCCCAAAGCCTGGGTGG - Intronic
1144736694 17:17559562-17559584 CAGAGGTGCCAAAGGCTGGTGGG + Intronic
1144785701 17:17830553-17830575 CAGGGACCCCAGAGCCTGGCAGG + Intronic
1145978690 17:28998777-28998799 CAGGGACCCCAGAGGCTTGCTGG + Intronic
1146545735 17:33736481-33736503 CACGGTCTCCATAGGCTGGCGGG - Intronic
1147023457 17:37559108-37559130 CAGAGAGCCCAAAGGATGGTAGG - Intronic
1147190975 17:38738059-38738081 CAGGGCCTCCTCAGGCTGGTTGG - Intronic
1148575146 17:48705328-48705350 CTGGGTCCGCAAAGGCAGATCGG + Intergenic
1148755396 17:49970373-49970395 GAAGGTAGCCAAAGGCTGGTAGG + Intronic
1148756417 17:49975447-49975469 CAGGGTCTCCAAATGTTTGTTGG - Intergenic
1149559588 17:57599061-57599083 CAGGCTCCACTAAGGCTGCTGGG + Intronic
1150610139 17:66727105-66727127 GGAGGTCCCCAAACGCTGGTGGG + Intronic
1151826975 17:76529192-76529214 CAGGGTCCCCATGGGCTCGAGGG - Intronic
1152103663 17:78316726-78316748 CAGGGGTCCCAGAGGGTGGTGGG - Intergenic
1152128578 17:78462209-78462231 CAGGGCCCCTCCAGGCTGGTGGG + Intronic
1152595001 17:81233648-81233670 CGGGGTCCCCAGAGGCTGGGAGG + Exonic
1152666879 17:81575719-81575741 AAGGTTCCCCAAAGGCAGGAGGG - Intronic
1156361229 18:36386392-36386414 CAGGGGCCTCAGAGGCTGCTGGG + Intronic
1157614279 18:48977581-48977603 CAGGGTCCAGAGAGGCCGGTAGG - Intergenic
1159775637 18:72600738-72600760 CAGTCTCCCCAAAGGCTTGGAGG + Intronic
1160259251 18:77275689-77275711 CAGGGTACACAAATGCTGTTTGG + Exonic
1160841014 19:1147066-1147088 CAGGGACCCCAAGGGCTGGGCGG + Intronic
1161662310 19:5554370-5554392 CATGGTGCCCACAGGCTAGTGGG + Intergenic
1164633263 19:29775360-29775382 CAGAGTCCCCACAGGCTGCAGGG - Intergenic
1165686430 19:37825004-37825026 CAGGGCCCCAAAAGGCAGGGTGG - Intergenic
1167433331 19:49465391-49465413 TAGGGTACCCAGAGGCTAGTGGG + Intronic
1167499380 19:49836681-49836703 AAGGGCCCCCAAAGGCTCATGGG + Intronic
926689017 2:15720019-15720041 CAGGGTCTGTAAAGGCTGGGTGG - Intronic
926697793 2:15782782-15782804 CGGGGTACCCAGAGGCTGCTTGG + Intergenic
927430008 2:23019531-23019553 AAGGGTCTCCAAAGGCTCATGGG - Intergenic
928868460 2:35946792-35946814 CAGGGTCCCCAGGGCCTGGCAGG + Intergenic
930258573 2:49119041-49119063 GGAGGTCCCCAAACGCTGGTAGG - Intronic
933979486 2:87538649-87538671 CAAGCCCACCAAAGGCTGGTGGG + Intergenic
935614794 2:105066764-105066786 CAGGGCAGCCCAAGGCTGGTTGG - Intronic
936314337 2:111412142-111412164 CAAGCCCACCAAAGGCTGGTGGG - Intergenic
938138916 2:128780934-128780956 CAGGGTCCCCAGACACTGGGTGG - Intergenic
941125628 2:161580221-161580243 CAGTGTCCCCAGAAGCTGGTGGG - Intronic
943620501 2:190142714-190142736 GGAGGTCCCCAAATGCTGGTGGG + Intronic
946174464 2:217913888-217913910 CAGGGTCACCAAGGGTTGTTTGG + Intronic
946191064 2:218008259-218008281 CAGGCCCCGCAAAGGCTGGAGGG + Intergenic
946245107 2:218382965-218382987 AAGGGTCCCCAAAGGCTAAGCGG + Exonic
948550929 2:238772681-238772703 CAGGGTCCCCACAGGCACGGAGG + Intergenic
1169035248 20:2445453-2445475 CAGCTTCCCAAAAGGCTGGTGGG - Intergenic
1172591580 20:36121799-36121821 CAGGGACCCCATACACTGGTGGG + Intronic
1172626440 20:36350154-36350176 CAGGGACCCAGAAGGCTGGCGGG + Intronic
1172636800 20:36415602-36415624 CAGTGTCCTCAAAGGGTTGTTGG - Intronic
1173466726 20:43288825-43288847 CAGGGTACCCATAGCCTGTTAGG - Intergenic
1173591909 20:44231433-44231455 CAGCCTCCCCAAAGGCAGGGAGG - Intergenic
1175133240 20:56805210-56805232 CAGTGTTCCCCAAGGTTGGTGGG + Intergenic
1175156718 20:56976430-56976452 CACGGTGCTCACAGGCTGGTGGG - Intergenic
1176219652 20:63963926-63963948 CAGGGGCCTCGAAGGCTTGTGGG + Intronic
1176240299 20:64072821-64072843 CGGGGTCCCCAGAGGCAGGCTGG - Intergenic
1176910690 21:14561312-14561334 CAGGCTCCCCAAAGGCTTGGAGG - Intronic
1179710052 21:43208123-43208145 CAGGGTTCCCTAAGCCTGGGAGG + Intergenic
1179726079 21:43341854-43341876 CAGGGTGCCCACAGGCTGTGAGG + Intergenic
1179881540 21:44295159-44295181 CAGGATCCCTAAAGGCTCCTCGG - Intronic
1180004448 21:45013582-45013604 CAAGGTCCCCAGACGCTGATGGG + Intergenic
1183264094 22:36815261-36815283 CAAGGACCAGAAAGGCTGGTAGG + Intronic
1183484662 22:38082527-38082549 CAGGGTTCCCACAGGCAGGAAGG + Intronic
950161255 3:10762992-10763014 CTTGGGACCCAAAGGCTGGTGGG - Intergenic
952777893 3:37064251-37064273 CAAAGTCCCCAAAAGCTAGTAGG + Intronic
953891729 3:46756184-46756206 CACGGTGGCCACAGGCTGGTGGG + Exonic
955786965 3:62551054-62551076 CATGGTACTTAAAGGCTGGTTGG - Intronic
961209776 3:125116706-125116728 CAGAGTCCCTAAAGGGTGGAAGG + Intronic
962974540 3:140434416-140434438 CATGGTTCCCAGGGGCTGGTTGG - Intronic
964357213 3:155861841-155861863 GGAGGTCCCCAAATGCTGGTGGG + Intergenic
967095773 3:186176061-186176083 CAGGGTACCCGAAGGCAGGGAGG + Intronic
967190382 3:186979500-186979522 GATGGTCCCCAAAGGAGGGTAGG + Intronic
968516859 4:1019115-1019137 AAGGGTCCCCAAAGGCATGCGGG - Intronic
969270198 4:6094482-6094504 CAGGGGCCCCGGAGGTTGGTAGG - Intronic
969842090 4:9890159-9890181 CAGGGTCCACACAGGCTGTCTGG + Intronic
970551205 4:17182914-17182936 CAGTGTCCCCGAAGGCATGTTGG - Intergenic
971940833 4:33213097-33213119 GATGGTCTCCAAATGCTGGTGGG - Intergenic
973618306 4:52702799-52702821 AAGAGTCCCCAAAGGCTAATTGG - Intergenic
976362282 4:84194419-84194441 CAGGGACTCCAAAAGCTGGGAGG + Intergenic
976635398 4:87282106-87282128 GGAGGTCCCCAAATGCTGGTGGG - Intergenic
977741664 4:100491501-100491523 AAGGCTCCCCATAGGCAGGTGGG + Intronic
977761117 4:100738493-100738515 CACTCTCCCCAAAGGCAGGTTGG - Intronic
979680476 4:123454188-123454210 CAGGGTCCTCTAAGGCAGGGAGG - Intergenic
980819426 4:137994387-137994409 CAGTCTCCCCAAAGGCTTGGAGG + Intergenic
982019932 4:151192699-151192721 CAGCGTTCACAAAGGCTTGTAGG - Intronic
982380076 4:154740636-154740658 CAGTGTCCCCGCAGGGTGGTCGG - Intronic
983866074 4:172768369-172768391 GGAGGTCCCCAAACGCTGGTGGG + Intronic
985650468 5:1105098-1105120 GAGGGTCCCCTTTGGCTGGTGGG - Intronic
985650497 5:1105195-1105217 GAGGGTCCCCTTTGGCTGGTGGG - Intronic
985650542 5:1105341-1105363 GAGGGTCCCCTTTGGCTGGTGGG - Intronic
985650571 5:1105438-1105460 CAGGGTCCCCTTTGGCTGGTGGG - Intronic
986332293 5:6726605-6726627 CAGGGTCCCAAATAGCTGATTGG + Intronic
992902448 5:81311479-81311501 CAGGGTCCCCTAAGGCTTACTGG - Intronic
995244435 5:109920642-109920664 CAGGGTCCTCAAAAGCTGCCGGG + Intergenic
995470721 5:112499496-112499518 CATGGTCTCCAAAGGTTGTTTGG - Intergenic
996353526 5:122572157-122572179 CAGGGTGCTCCAATGCTGGTAGG - Intergenic
997532194 5:134588443-134588465 CAGGGTCCCCATTTGCTGGCTGG + Intergenic
1000017800 5:157293807-157293829 CAGTCTCCCCAAAGGCTTGGAGG + Intronic
1001945512 5:175774545-175774567 CCAGCTCCCCAAATGCTGGTGGG - Intergenic
1006293786 6:33160818-33160840 CAGTGTCTCCATTGGCTGGTGGG - Intergenic
1007207140 6:40162007-40162029 CAGGGTTCCCAAAGTATGGCTGG - Intergenic
1007736530 6:43985550-43985572 CAGGCTCTGCAAATGCTGGTAGG - Intergenic
1008513214 6:52296678-52296700 GAGGGTCCCATAAGCCTGGTCGG - Intergenic
1011900146 6:92284249-92284271 CACGGGCCCCAAAGGCAGCTGGG - Intergenic
1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG + Intergenic
1019422409 7:957207-957229 CAAGGTCCCCAAAGACGGGGAGG + Intronic
1019539783 7:1546447-1546469 CGGGGTCCACACAGGCTGGCCGG - Exonic
1019571171 7:1713100-1713122 CAGGCTCACCACAGCCTGGTGGG + Intronic
1019628305 7:2032668-2032690 CAGGGTCCCTCGAGCCTGGTGGG - Intronic
1019732443 7:2635408-2635430 CGGGGTCACAAAGGGCTGGTGGG - Intronic
1019907398 7:4075103-4075125 CAGAGACCCCAAAGGCAGGCAGG + Intronic
1022088963 7:27095655-27095677 CAGGTTCCCGGAAGTCTGGTAGG + Exonic
1025129276 7:56367304-56367326 CAGGGTCTACAAACGCCGGTGGG - Intergenic
1026972462 7:74476710-74476732 CACTGGCCCCAAAGGCTGGGTGG - Intronic
1027190324 7:75992633-75992655 CAGGCTCCCCCAGGGCTGCTGGG + Intronic
1034997856 7:155589716-155589738 CTGGCTCCTCAAAGCCTGGTGGG + Intergenic
1035109321 7:156467378-156467400 CAGAGTCCCCAAAGGTTGGAGGG - Intergenic
1035304906 7:157925655-157925677 CAGGGTCCCCAGCGGCTCCTGGG - Intronic
1035458951 7:159027543-159027565 GAAAGTCACCAAAGGCTGGTTGG + Intergenic
1036664049 8:10727378-10727400 AAGGGTCCCCAAAAGATGGCTGG - Intronic
1037469758 8:19195848-19195870 CACTGTCCCGAAAGGCTGGCAGG + Intergenic
1037672737 8:21029187-21029209 CCGGCTCCCCAACGGCTTGTGGG + Intergenic
1038158230 8:25011322-25011344 CAGGGTCTCCAAAGTTTAGTAGG + Intergenic
1038279710 8:26152866-26152888 GTAGGTCCCCAAATGCTGGTGGG + Intergenic
1039727376 8:40233279-40233301 CAGCCTCCCCAAAGGCTTGGAGG - Intergenic
1039894578 8:41707427-41707449 CAGGCTGCCCAGAGGCTTGTGGG + Intronic
1040855900 8:51947783-51947805 CAGTCTCCCCAAAGGCTTGGAGG + Intergenic
1045104290 8:98876169-98876191 GAGGGACCCCAAAGGCTGAAGGG - Intronic
1049147636 8:141013294-141013316 CAGGTTGCTCACAGGCTGGTGGG + Intergenic
1049579268 8:143404053-143404075 CAGGGTGGGCAAAGGCTGGGAGG - Intergenic
1053168101 9:35858910-35858932 CAGGTCCACCAGAGGCTGGTGGG - Intergenic
1056335041 9:85560049-85560071 GGGGGTCTCCAAATGCTGGTGGG - Intronic
1056532452 9:87498722-87498744 CGGCGTCCCCAAACGCTGGGCGG - Intronic
1056753578 9:89368478-89368500 AAGGGTCCCCAGAGTCTGGGAGG - Intronic
1057221402 9:93259642-93259664 GAGGGTCCCCAGACGCTGGGAGG - Intronic
1057309962 9:93936189-93936211 CAGGGTCCCCAGCGGATGTTAGG - Intergenic
1057806436 9:98223066-98223088 CAAGGACTGCAAAGGCTGGTGGG + Intronic
1057951034 9:99369280-99369302 GAGGGCCCCCAAAGGCTTGGAGG - Intergenic
1059412242 9:114139643-114139665 CAGGGTCCCCAGAGGAAGGGAGG + Intergenic
1059419385 9:114181532-114181554 CAGTGTGCCTAGAGGCTGGTGGG + Intronic
1060066879 9:120510053-120510075 CAGTGTCTCTACAGGCTGGTTGG - Intronic
1060689347 9:125642836-125642858 GGAGGTCCCCAAATGCTGGTGGG - Intronic
1061293943 9:129666971-129666993 CAGGGTCCCCCGGGGCGGGTGGG - Intronic
1061848276 9:133400326-133400348 CAGGGCCCCCAGAGGCTGGTAGG - Intronic
1062187132 9:135224104-135224126 CAGGGTGCCCATAGGCGGGTGGG - Intergenic
1062307702 9:135919030-135919052 CAGGGTCTCCAAGGGGTGTTTGG + Intergenic
1185715030 X:2334838-2334860 CAGGGTTCACAAAGGCTTGGAGG - Intronic
1186251512 X:7672077-7672099 CAGGGTTCCCATTGGCTGCTTGG - Intergenic
1187155090 X:16714355-16714377 GAGGGTCCCAAAAGGATGGCAGG + Intergenic
1188034790 X:25305349-25305371 CAGCCTCCCCACAGGCTGTTAGG + Intergenic
1190211823 X:48455000-48455022 CATGGTTCCCAAAGGCTGGGCGG + Intergenic
1190292232 X:49000732-49000754 CAGGGTCCTATAGGGCTGGTAGG - Intronic
1190581585 X:51896283-51896305 CAGGGTGACCAATGGCTAGTGGG + Intronic
1193016406 X:76738758-76738780 CAGGGACCCCAAGGGCCTGTTGG - Intergenic
1199034538 X:143034215-143034237 CAGGATCTCCACAGGATGGTGGG + Exonic
1199503632 X:148537181-148537203 GAGGGTCCCCAAAGGCAGCTGGG - Intronic
1199726598 X:150589057-150589079 TAGAGGCCCCAAAGGTTGGTTGG + Intronic
1199739027 X:150715150-150715172 CAGGGTCACCAAAGGAGAGTGGG - Intronic
1200034147 X:153317550-153317572 CAGGGTCCCTGAAGGCCTGTGGG - Intergenic