ID: 1130894476

View in Genome Browser
Species Human (GRCh38)
Location 15:88159596-88159618
Sequence GTCTACTTCTTTAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130894476_1130894480 -1 Left 1130894476 15:88159596-88159618 CCCTCTGCCCTAAAGAAGTAGAC 0: 1
1: 0
2: 2
3: 5
4: 120
Right 1130894480 15:88159618-88159640 CAATCGTATATGCACATATAAGG 0: 1
1: 0
2: 0
3: 10
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130894476 Original CRISPR GTCTACTTCTTTAGGGCAGA GGG (reversed) Intronic
901931873 1:12601176-12601198 GTCGGCTTCTGCAGGGCAGATGG - Intronic
910693719 1:89990675-89990697 GTCTTCTCTTTTAGGGAAGAGGG + Intergenic
913662509 1:121016788-121016810 GTGTAATTCTGCAGGGCAGAAGG + Intergenic
914013887 1:143799984-143800006 GTGTAATTCTGCAGGGCAGAAGG + Intergenic
914163936 1:145161213-145161235 GTGTAATTCTGCAGGGCAGAAGG - Intergenic
914652510 1:149708603-149708625 GTGTAATTCTGCAGGGCAGAAGG + Intergenic
914726471 1:150331816-150331838 CTGAACTTCTTTAGGACAGAAGG + Intronic
919808391 1:201394442-201394464 CTCTACTTCCTCAGGGGAGATGG + Intronic
1064042044 10:11975285-11975307 GCCTACTTCTTTAGTGATGAGGG - Intronic
1065240806 10:23702204-23702226 GTACAGTTCTTTAGGGAAGAGGG + Intronic
1066052537 10:31648794-31648816 GTCTATTTCATTAGGGAAGGTGG + Intergenic
1069203185 10:65649037-65649059 GTAAACTTCTTTAAGCCAGAAGG - Intergenic
1071896708 10:90075882-90075904 GACTACTCCTTCAGGGCAGTGGG + Intergenic
1072628706 10:97131165-97131187 GTGTGGCTCTTTAGGGCAGAAGG - Intronic
1076305095 10:129460762-129460784 CTCTACTGCTTTGGGGAAGATGG + Intergenic
1076455533 10:130591041-130591063 GTCTACTCATTTACGGCTGATGG + Intergenic
1079417642 11:20254405-20254427 GTCTTCATCTTGAGGGCAGTAGG + Intergenic
1083132600 11:60639710-60639732 GTCAACTTCTTTTGGATAGAAGG + Intergenic
1088439863 11:109858175-109858197 GTAAACTTCTTTAGGGCCTATGG - Intergenic
1089358814 11:117873113-117873135 GTTTTTTTCTTTAGGGCTGAGGG - Intronic
1089918160 11:122179775-122179797 GTCTACCTGTTTAGGTCAAAAGG + Intergenic
1091028276 11:132160961-132160983 GGATATTTCTTAAGGGCAGAAGG + Intronic
1091365644 11:135017527-135017549 GTCAACTTCCACAGGGCAGAGGG - Intergenic
1092206907 12:6620341-6620363 GTGTACTACTTTAGCGCCGAGGG - Exonic
1093228665 12:16515949-16515971 GTCTACATAATTAGAGCAGATGG - Intronic
1094253359 12:28392846-28392868 TTCTACTTCTTCAGGTCAAAAGG - Intronic
1094615507 12:32032845-32032867 GTCAACTCCTTTAGGGTAGGGGG + Intergenic
1099396678 12:82148311-82148333 GTCTACTACTTGAGGGTGGAAGG - Intergenic
1099488867 12:83262394-83262416 GTACACATCTTTAGTGCAGAAGG - Intergenic
1099610115 12:84857460-84857482 GTCTTTTCCTTCAGGGCAGAAGG + Intergenic
1100467587 12:94860872-94860894 CTCTAATGCTTTAGGGCAAAGGG + Intergenic
1100905825 12:99297996-99298018 GTCTAATGCCTTAGTGCAGAAGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105412319 13:20180917-20180939 GTCAAGTTATTTAGGGGAGAAGG - Intergenic
1106567071 13:30895491-30895513 GTCTATCTGTTTAGAGCAGAGGG - Intergenic
1108834721 13:54528974-54528996 GTTTACTTCTTTAGAAAAGAAGG - Intergenic
1115404797 14:33002548-33002570 CTCTAATTCTGTAGGGCACAGGG - Intronic
1118194105 14:63608752-63608774 CTCAACTTCTTAAAGGCAGAAGG - Intronic
1118353002 14:64987341-64987363 TTCTCGTTCTTTAGGGCAGAGGG - Intronic
1118392288 14:65305407-65305429 GGATACAACTTTAGGGCAGATGG + Intergenic
1122557902 14:102591673-102591695 GTCAACTTCTTTCGGGGCGAGGG - Intergenic
1123387276 15:19826138-19826160 GTCTAGTTCTTAAGTGAAGATGG + Intergenic
1125747871 15:42009522-42009544 GACTCCTTCCTGAGGGCAGAAGG - Intronic
1128157972 15:65403789-65403811 TTCTATTTCTTTAGCCCAGAGGG - Intronic
1130894476 15:88159596-88159618 GTCTACTTCTTTAGGGCAGAGGG - Intronic
1138683829 16:58707179-58707201 GTCTACATGGTTAGAGCAGATGG + Exonic
1139488333 16:67271748-67271770 GTCCATTTTTTTAGGGCAGTGGG + Exonic
1146824983 17:36014111-36014133 GTCTGCTCCTTTGGGGCAGAAGG - Intronic
1148608109 17:48945189-48945211 GTTAACTCCTTTAGGGCAGAGGG - Intergenic
1149204908 17:54232877-54232899 GTCATCTTCTTAAGGTCAGAGGG - Intergenic
1149288824 17:55195767-55195789 GTAAACTTCTTGAGGGCAGGGGG + Intergenic
1153621239 18:6979951-6979973 GTCTACATGATTAGAGCAGATGG - Intronic
1157175010 18:45443649-45443671 GTGATCTTCTGTAGGGCAGAGGG + Intronic
1159933911 18:74344997-74345019 CTATACTGCTTTGGGGCAGAGGG - Intronic
1160449867 18:78955265-78955287 GTGTACTTCTCTGGGGGAGATGG - Intergenic
928586612 2:32765489-32765511 GCCTAATTCTTTAGGGCTGTGGG + Intronic
932756562 2:74413969-74413991 GTCTACTCCTTTGGGGGACAGGG + Intergenic
933700436 2:85251566-85251588 GTTTACCTCTTCAGGACAGAAGG + Intronic
935787230 2:106560280-106560302 GGCTACTTCTTTATGGCACCAGG + Intergenic
936795294 2:116196263-116196285 GTCAATTTCTTTAAGGCAGTGGG + Intergenic
940613126 2:156015732-156015754 GTCTAATCCTTTAGGAGAGATGG - Intergenic
948111058 2:235456356-235456378 GCCTGCTTCCTTAAGGCAGAGGG + Intergenic
1170609593 20:17901698-17901720 GTCTACTTGTTTAGGGCAGTGGG + Intergenic
1175632149 20:60550296-60550318 GTCTCTTCCTTTAGGGCAGTGGG + Intergenic
1182682953 22:32096756-32096778 GTCAACCTCCTTAGGGCAGGTGG + Intronic
1185355061 22:50363559-50363581 CTCTTCTTCTTGAGGGCATATGG + Intronic
949645492 3:6088949-6088971 GTCCACTTCTTTAGGCCACTGGG - Intergenic
951292754 3:20893679-20893701 TTCTACGTATTTAGGCCAGATGG - Intergenic
951294387 3:20916277-20916299 CTCTTCTCCTTTAGGGCACAAGG - Intergenic
956195310 3:66648500-66648522 TTCTACTACTTTAGGGCAGATGG + Intergenic
956817833 3:72924506-72924528 GTCTTTTTCTTAAGGGCAGTGGG + Intronic
957118144 3:76054279-76054301 ATTTAGTTCTTTAGGTCAGATGG + Intronic
958195508 3:90237592-90237614 TTCTACTTATTTAAGGCAGGAGG + Intergenic
958712677 3:97737139-97737161 CTGGACTTCTTTAGGGAAGATGG - Intronic
959631585 3:108513122-108513144 GTTTACTTCTTTTGGGCATTCGG - Intronic
961971333 3:130971739-130971761 TGCTGCTTCTTTAGGCCAGACGG + Intronic
962338296 3:134558631-134558653 TTCTACTTCTTATGGGCAAATGG - Intronic
962886456 3:139632423-139632445 CTCCAGTTCTGTAGGGCAGAGGG - Intronic
964742444 3:159981078-159981100 GTCTACTTCTTTAGAGGCAATGG + Intergenic
966854122 3:184182576-184182598 GTCTACTTCTTTAGAACAACAGG - Intronic
969320569 4:6409951-6409973 CTCTACTTCCTGAGAGCAGAAGG - Intronic
969634529 4:8359218-8359240 GTCTACTTCTTTTGGGTTGAGGG - Intergenic
970044090 4:11830273-11830295 GTCTCCAGCTTGAGGGCAGAGGG + Intergenic
970366927 4:15368867-15368889 GCAGAGTTCTTTAGGGCAGATGG + Intronic
971754797 4:30693810-30693832 ATGTACTTCTTAAGGGCACATGG - Intergenic
978155709 4:105487515-105487537 GTTTACTTCTTTTGGGCATTAGG - Intergenic
982109680 4:152042370-152042392 GGCTACTTATTTAGTGCATAGGG - Intergenic
982507623 4:156240006-156240028 GACTGCTTCTTTCAGGCAGAAGG + Intergenic
984451898 4:179913133-179913155 TTCTACTGCTTTATGGCAGAAGG + Intergenic
984540839 4:181035188-181035210 TTCTACATCATTATGGCAGAGGG + Intergenic
990605368 5:57404021-57404043 GTCTACATATTTAGAGCAGTGGG + Intergenic
991277464 5:64866467-64866489 CTCTAGTTTTTTAGGGTAGAAGG + Intronic
993751720 5:91677607-91677629 TTCTACTTTTTTAGTGGAGACGG + Intergenic
994164767 5:96597276-96597298 CTTTTCTTTTTTAGGGCAGATGG - Intronic
997159210 5:131589431-131589453 GTCTCCTTATTTGGGGGAGAGGG + Intronic
997981656 5:138471215-138471237 CTCTATTTCTTTAAAGCAGAGGG + Intergenic
1002819338 6:710522-710544 GTTTACTTCTTCAGGGAAAAGGG - Intergenic
1003417372 6:5923398-5923420 ATCTAATTCTTTTAGGCAGAAGG - Intergenic
1003702402 6:8482168-8482190 TTCTAGTTATTTAAGGCAGAAGG + Intergenic
1009512228 6:64567840-64567862 TTCTAGTTGTTTAGAGCAGAAGG - Intronic
1009532408 6:64835949-64835971 CTCTACTTCTTTTGGGCTAATGG + Intronic
1010987523 6:82441996-82442018 GTCTACTTCTCTGGAGAAGATGG + Intergenic
1011466066 6:87658571-87658593 ATCTACTTCATTAGGTCAGGTGG + Intronic
1015392882 6:132702612-132702634 GTCTCCTTTCTTAAGGCAGAGGG - Intronic
1022332921 7:29397213-29397235 GTCTACTTTTTAAGGATAGAGGG + Intronic
1022982127 7:35613896-35613918 GTGTAGTTCTTTGAGGCAGATGG + Intergenic
1024767931 7:52683535-52683557 GTCTACTTAATTAGGCCATAGGG + Intergenic
1026297546 7:69068146-69068168 GTCTACCTCTTTAGGAGACATGG + Intergenic
1029028847 7:97447733-97447755 ATGAAGTTCTTTAGGGCAGATGG - Intergenic
1031876497 7:127147566-127147588 GTATACTTGTACAGGGCAGAAGG - Intronic
1038261962 8:26003409-26003431 ATCTCCTTCTTTTGGGGAGAGGG - Intronic
1038498451 8:28023916-28023938 GTCAACTTGTTTAGGTCACAGGG + Intronic
1040387592 8:46924075-46924097 CTCTCCTCCTTTAGGGAAGATGG - Intergenic
1041587005 8:59532657-59532679 GTCTATTTTTTTAAGTCAGACGG + Intergenic
1042013829 8:64284422-64284444 GTGTCCTGCTTTAGGGGAGAAGG - Intergenic
1042982495 8:74546278-74546300 GTCTACTCATTTAGGGCATTGGG + Intergenic
1043300096 8:78717314-78717336 CTTTACTTTTTTAGGCCAGATGG + Exonic
1044464294 8:92485514-92485536 GTCTACTACTTCATGGAAGAAGG + Intergenic
1047390689 8:124448349-124448371 GTCTATTTCTTTTGGGTTGAAGG + Intergenic
1048903780 8:139067119-139067141 GTCTACCGTGTTAGGGCAGAAGG + Intergenic
1052223213 9:26052925-26052947 GTCCATTACATTAGGGCAGAGGG - Intergenic
1059937048 9:119321887-119321909 TTCTACTTCTATTGGGCAGCGGG + Intronic
1187613961 X:20972913-20972935 TTCTGCTTCTTTGGGGCAGGAGG + Intergenic
1188065592 X:25655794-25655816 CTCTACTTCTGTATGGAAGAAGG + Intergenic
1189148612 X:38681529-38681551 GGCTACTTCTGTAGGTCAAATGG + Intronic
1197992938 X:132337660-132337682 ATCTACTTCTTTAGAGCACTTGG + Intergenic
1198716722 X:139565630-139565652 GTCTATATTTTTAGGGCAGCTGG + Intergenic
1200164813 X:154028783-154028805 GTCCACTTCTCTAGAGTAGAAGG + Intronic