ID: 1130897682

View in Genome Browser
Species Human (GRCh38)
Location 15:88183666-88183688
Sequence GCCCTGGGGCGTGTGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 298}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130897682_1130897689 -6 Left 1130897682 15:88183666-88183688 CCTGGGCTCACACGCCCCAGGGC 0: 1
1: 0
2: 3
3: 32
4: 298
Right 1130897689 15:88183683-88183705 CAGGGCCCCGTGAGGCTGGGAGG 0: 1
1: 0
2: 5
3: 42
4: 455
1130897682_1130897695 1 Left 1130897682 15:88183666-88183688 CCTGGGCTCACACGCCCCAGGGC 0: 1
1: 0
2: 3
3: 32
4: 298
Right 1130897695 15:88183690-88183712 CCGTGAGGCTGGGAGGTCAGGGG 0: 2
1: 0
2: 2
3: 41
4: 396
1130897682_1130897696 10 Left 1130897682 15:88183666-88183688 CCTGGGCTCACACGCCCCAGGGC 0: 1
1: 0
2: 3
3: 32
4: 298
Right 1130897696 15:88183699-88183721 TGGGAGGTCAGGGGTCATACTGG 0: 1
1: 0
2: 0
3: 22
4: 202
1130897682_1130897693 0 Left 1130897682 15:88183666-88183688 CCTGGGCTCACACGCCCCAGGGC 0: 1
1: 0
2: 3
3: 32
4: 298
Right 1130897693 15:88183689-88183711 CCCGTGAGGCTGGGAGGTCAGGG 0: 1
1: 2
2: 99
3: 1621
4: 5773
1130897682_1130897691 -1 Left 1130897682 15:88183666-88183688 CCTGGGCTCACACGCCCCAGGGC 0: 1
1: 0
2: 3
3: 32
4: 298
Right 1130897691 15:88183688-88183710 CCCCGTGAGGCTGGGAGGTCAGG 0: 1
1: 0
2: 2
3: 30
4: 457
1130897682_1130897684 -10 Left 1130897682 15:88183666-88183688 CCTGGGCTCACACGCCCCAGGGC 0: 1
1: 0
2: 3
3: 32
4: 298
Right 1130897684 15:88183679-88183701 GCCCCAGGGCCCCGTGAGGCTGG 0: 1
1: 0
2: 2
3: 39
4: 443
1130897682_1130897686 -9 Left 1130897682 15:88183666-88183688 CCTGGGCTCACACGCCCCAGGGC 0: 1
1: 0
2: 3
3: 32
4: 298
Right 1130897686 15:88183680-88183702 CCCCAGGGCCCCGTGAGGCTGGG 0: 1
1: 0
2: 2
3: 39
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130897682 Original CRISPR GCCCTGGGGCGTGTGAGCCC AGG (reversed) Intronic
900374182 1:2345886-2345908 GGCCTGGGGCGTGTGAGCTCGGG - Intronic
901130742 1:6961548-6961570 AGCCGGGGGCGTGAGAGCCCAGG + Intronic
901325783 1:8364375-8364397 GCCCTGGGGTGTTGGGGCCCAGG - Intronic
901655064 1:10764614-10764636 GCCTTGGAGCCTGTCAGCCCAGG - Intronic
902150735 1:14441088-14441110 GCCCTGGGGCTTCAGAGGCCTGG - Intergenic
902648804 1:17823147-17823169 GCCCGTAGGCGTGTGAGCCTGGG + Exonic
903660386 1:24973467-24973489 CCCCTGGGGCGTGGGAGCTGGGG + Intergenic
904494513 1:30879098-30879120 GCCCTGGGGCATGTGTGAGCAGG + Intronic
906477022 1:46176201-46176223 GCCAGGGGGCCTGTGAGCCAGGG - Intronic
910771307 1:90835485-90835507 GCCCTGGGGCTTCTGCGGCCTGG - Intergenic
911228964 1:95339603-95339625 TCCCTGGGGGGTATGAGCCTTGG + Intergenic
912452042 1:109773259-109773281 GCCCTGGGGCTGGAGAGTCCCGG - Intronic
915332870 1:155124602-155124624 GCCCTGGGGCAAGTGAAACCTGG - Intergenic
916716191 1:167448532-167448554 GCACTGGGCAGTGTGAGTCCTGG - Intronic
916922783 1:169486108-169486130 GCCCTGGGACGTCAGAGGCCTGG - Intergenic
917028248 1:170664477-170664499 GCCCACGGGGGTGTGTGCCCGGG + Intronic
920510387 1:206547231-206547253 GCCCTGGGGGCTGGGACCCCTGG - Intronic
921174896 1:212585217-212585239 GCTCTGGGGCTGCTGAGCCCAGG + Intronic
922586677 1:226738670-226738692 GCCCTGGGGTGTTAGAGCGCCGG - Intronic
923729915 1:236540209-236540231 GCCCTGGAGATTGTGAACCCAGG - Intronic
923750954 1:236745632-236745654 GCTCTGTGTAGTGTGAGCCCTGG + Intronic
924847944 1:247791615-247791637 GCCCAGGGGCTGGTGAGCCAGGG - Intergenic
1062914003 10:1233605-1233627 GCCCTGGGCTGTGAAAGCCCAGG + Intronic
1063058394 10:2526146-2526168 GCCCTCAGGGGTGTGAGTCCTGG - Intergenic
1063864034 10:10344772-10344794 TTCCTGGGGCATGTGAACCCAGG - Intergenic
1065952938 10:30668206-30668228 GGCCTGGGCTGTGTGAACCCAGG - Intergenic
1067806611 10:49397373-49397395 GCTCTGGAGCGACTGAGCCCAGG - Intergenic
1069892709 10:71661993-71662015 GCCCTGGGCTGCGTGGGCCCAGG + Intronic
1070614997 10:77962727-77962749 GGCCTGGAGCGTGAGAACCCTGG + Intergenic
1070906608 10:80078850-80078872 GGCCCGCGGCCTGTGAGCCCAGG - Intronic
1070960970 10:80499978-80500000 GCCCTGGCTGCTGTGAGCCCTGG - Intronic
1071523656 10:86346041-86346063 GCCCAGGGGTGTGGGAGCACAGG - Intronic
1071601665 10:86961526-86961548 GCCCTGGGGTGAGGGTGCCCGGG + Intronic
1072253835 10:93601620-93601642 TCCCTGGTGCGTGAGTGCCCAGG + Exonic
1073242248 10:102066289-102066311 GCCCTGGGGAGTTGGGGCCCAGG - Exonic
1075643880 10:124084969-124084991 GCCCCGGGGAGTGTGGGCCGAGG - Intronic
1076356759 10:129858757-129858779 GCCCTGGAGCCTCTGAGGCCTGG - Intronic
1076366195 10:129922360-129922382 GCACTGGGGCCTGTGTGGCCTGG - Intronic
1076706722 10:132306423-132306445 ACCCTGGAGCGTGTGGGGCCTGG + Intronic
1076806042 10:132859270-132859292 GCCCTGGGGCTTCTGACTCCAGG - Intronic
1077062041 11:621761-621783 GCACGGGGGTGTGGGAGCCCAGG - Intronic
1077110201 11:858929-858951 GCTGTTGGGGGTGTGAGCCCGGG - Intronic
1077110248 11:859101-859123 GCCAGGGCACGTGTGAGCCCGGG - Intronic
1077110257 11:859135-859157 GCCGGGGTGCATGTGAGCCCAGG - Intronic
1077110307 11:859331-859353 CCCGGGGTGCGTGTGAGCCCGGG - Intronic
1077110323 11:859383-859405 GCCGGGGTGCATGTGAGCCCGGG - Intronic
1077110345 11:859463-859485 CCCGGGGTGCGTGTGAGCCCGGG - Intronic
1077110350 11:859480-859502 CCCGGGGTGCGTGTGAGCCCGGG - Intronic
1077136382 11:1001398-1001420 GCCCTGTGGGGTGGGAGCGCAGG + Intronic
1077206301 11:1346431-1346453 GCCCTGGGGTGGGTGAGGACAGG + Intergenic
1077332585 11:1989950-1989972 GGCCTGGGGAGTGAGGGCCCAGG + Intergenic
1077372551 11:2190209-2190231 GCCCTGGGGCGTGTCCCCTCTGG + Intergenic
1077434432 11:2531979-2532001 GGCCTGGAGTGAGTGAGCCCAGG - Intronic
1077545054 11:3165494-3165516 GCCCGGGTGGGTGTGAGCCCCGG - Intronic
1077602127 11:3581201-3581223 GAGCTGGGGCGTCTGAGCGCGGG + Intergenic
1078315382 11:10289595-10289617 GCCCTTGGGAGTGTCAGGCCTGG + Intronic
1081549252 11:44096409-44096431 GGCCGGGGGCGTGTTAGGCCGGG + Intronic
1083294039 11:61705791-61705813 GCCCTGGGTGGTGTGAACACAGG - Intronic
1083622744 11:64057033-64057055 GGCCTGGAGCCTGGGAGCCCAGG - Intronic
1083758758 11:64804738-64804760 GCCGTGGGGCGAGGAAGCCCGGG - Exonic
1083816505 11:65135228-65135250 GTCCTTGGGCGAGTGATCCCTGG + Intergenic
1084062818 11:66687123-66687145 GTCCTGCGGCGTGGGAGCCTCGG - Exonic
1084121522 11:67071735-67071757 GCCCTGAGGCCTGGGAGTCCTGG + Exonic
1084258030 11:67955756-67955778 GAGCTGGGGCGTCTGAGCGCGGG + Intergenic
1084664851 11:70570789-70570811 GCCCTGGTGGGTGTGGGCCCCGG - Intronic
1084694334 11:70744748-70744770 GCCCTGGGCTGTGGGAGCCCTGG + Intronic
1084787187 11:71449079-71449101 GACCTGGGGCGAGGCAGCCCTGG + Intronic
1084814722 11:71639463-71639485 GAGCTGGGGCGTCTGAGCGCGGG - Intergenic
1084849540 11:71927982-71928004 GCCCAGAGGCGTGTGAGCTGGGG + Intronic
1086322496 11:85664933-85664955 GCCCTGGGGCCTGGGATCCTTGG - Exonic
1089401425 11:118166664-118166686 GCTCTGGGACGTGTGGGCCCTGG - Exonic
1089540817 11:119188139-119188161 GCCCTGGTGAGTGGGAGCCCTGG + Exonic
1090773691 11:129944916-129944938 GCCCTGGCCCGGGTGAGCACCGG + Exonic
1202815567 11_KI270721v1_random:45126-45148 GGCCTGGGGAGTGAGGGCCCAGG + Intergenic
1092428273 12:8390553-8390575 GAGCTGGGGCGTCTGAGCGCGGG + Intergenic
1092429349 12:8396706-8396728 GAGCTGGGGCGTCTGAGCGCGGG + Intergenic
1092581734 12:9849711-9849733 GCCCTGGTGCGTGTAGGCACTGG + Intergenic
1094368927 12:29714780-29714802 TCCCTGGGGAGTCTGAGCCAGGG - Intronic
1095977476 12:47949623-47949645 GCCAGGGGGCGTGGGAGGCCTGG - Intergenic
1096651212 12:53062779-53062801 GCCTTGAGGTGGGTGAGCCCTGG + Intronic
1097248905 12:57621633-57621655 GCGCCGGGGCGCATGAGCCCTGG + Intronic
1098147251 12:67510421-67510443 GACCTGGGACTTTTGAGCCCAGG - Intergenic
1102811338 12:115826845-115826867 GCCCTGGGGCGGGTCAGGCTTGG - Intergenic
1103596485 12:122027198-122027220 TCCCTGGGGCATGTGGGCCCAGG + Intronic
1103874872 12:124119313-124119335 GCGCTGGGGGGCGAGAGCCCTGG - Intronic
1104585590 12:130045619-130045641 GCCCTGAAGCCTGTGAACCCTGG - Intergenic
1104831900 12:131758122-131758144 GCCCCAGGGTTTGTGAGCCCAGG + Intronic
1105296039 13:19088706-19088728 GCCCTGGTGTGTGTGAGGGCTGG - Intergenic
1105617323 13:22030546-22030568 GTCCTGGAGTCTGTGAGCCCTGG + Intergenic
1105854353 13:24361526-24361548 GCCATGGGGGCTGGGAGCCCCGG + Intergenic
1107750609 13:43561751-43561773 AGGCTGAGGCGTGTGAGCCCAGG + Intronic
1108590270 13:51906723-51906745 GCCCTAGGGCCTGGGATCCCGGG - Intergenic
1110035175 13:70673368-70673390 GCACTGGAGAGTGTGAGCCAAGG - Intergenic
1113384197 13:109833258-109833280 GCCCTAGGGCAGGAGAGCCCGGG - Intergenic
1113416219 13:110130738-110130760 GCCCTGAGGCTGGTGACCCCTGG - Intergenic
1118709686 14:68509105-68509127 GCCCAGTGGCTGGTGAGCCCAGG - Intronic
1118846570 14:69551854-69551876 ACCCTGGGCTGTGTGAGTCCAGG - Intergenic
1120187982 14:81414370-81414392 GCCCTGGCGTGTGAGAGCACTGG - Intronic
1121111115 14:91313807-91313829 GCCCTGGAGCATGAGAGCCAGGG - Exonic
1121548690 14:94781745-94781767 GCCCTGGGGCTCGTGGCCCCCGG + Intergenic
1122577369 14:102750813-102750835 TCCCTGGGGGGACTGAGCCCTGG - Intergenic
1122722585 14:103730545-103730567 GCCCTGGGGAGGGTCTGCCCGGG - Intronic
1122837615 14:104437800-104437822 TCCCTGGTGGGTGAGAGCCCAGG + Intergenic
1122880844 14:104689833-104689855 GGGCTGCGGCGTGTGTGCCCAGG + Intronic
1123998796 15:25737535-25737557 GCCCTGGGGAGTGTGCGCAGGGG + Intronic
1124372543 15:29111762-29111784 GCCCTGGGGTGGATGAGCCCTGG - Intronic
1125751740 15:42033795-42033817 GCCCTGGGTGGAGTGGGCCCTGG + Intronic
1128161577 15:65426172-65426194 GCCCTGGGCTGTGAGAGCACAGG + Intergenic
1129520823 15:76185010-76185032 GCACAGGCCCGTGTGAGCCCTGG + Intronic
1130149145 15:81298180-81298202 GGCCTTGGGCAAGTGAGCCCAGG - Intronic
1130897682 15:88183666-88183688 GCCCTGGGGCGTGTGAGCCCAGG - Intronic
1131343883 15:91628188-91628210 GCACTGCGGTGTGTGAACCCAGG - Intergenic
1132383985 15:101387015-101387037 AGCCTGGAGAGTGTGAGCCCAGG - Intronic
1132547683 16:540757-540779 GCCATGTGGCCTGTGACCCCCGG - Intronic
1132571532 16:646504-646526 GCGCTGGGGCACCTGAGCCCAGG + Intronic
1132573878 16:656035-656057 GCCCTGGGGCGGCTGATGCCAGG + Intronic
1133324810 16:4936340-4936362 GCCCTGGGGGGTGTGGGGTCGGG - Intronic
1133369955 16:5239800-5239822 GAGCTGGGGCGTCTGAGCGCGGG - Intergenic
1133763861 16:8821673-8821695 GCCCTAGGGCGAGTGACCCTTGG - Intronic
1135547609 16:23376572-23376594 GAGCTGGGGCCTGGGAGCCCTGG + Intronic
1137442784 16:48510723-48510745 GCCCTGGGGCATCTCACCCCAGG + Intergenic
1137535011 16:49314034-49314056 CCCCAGGAGCGTGTGAGCCTTGG + Intergenic
1137563036 16:49515224-49515246 GCCATGGGGCCTGTGCGCGCGGG - Intronic
1138127136 16:54448114-54448136 GGCCTGGGGAGTGTGTGCCAGGG - Intergenic
1140989281 16:80192615-80192637 GCCCTCGGATGTGTGAGCCTAGG - Intergenic
1141143732 16:81514638-81514660 GCTCTGGAGCCTGAGAGCCCAGG + Intronic
1141616649 16:85213693-85213715 CCCCTGATGCGTGTGAGTCCAGG - Intergenic
1142155137 16:88529589-88529611 GCCCTGGGGCCTGTGGACCCTGG + Intronic
1142222402 16:88861976-88861998 ACCCTGGGGCGGGGGAGGCCTGG - Exonic
1142474075 17:179766-179788 GCCCTGGGGCGTGGGGGCTGGGG - Intronic
1142764190 17:2056502-2056524 GCCCTCTGGAGTGGGAGCCCAGG - Intronic
1142998392 17:3775022-3775044 GCCCGGGGGCGGGTGAGTCGAGG - Intronic
1143119142 17:4596527-4596549 GCCCAGGGCCATGTGAGCCAAGG + Intronic
1144740559 17:17579998-17580020 GCTCTGGGGAGTGTGGGCCTAGG - Intronic
1145977443 17:28992619-28992641 GCCCTGGGGCGGGTCAGGTCAGG - Intronic
1147046237 17:37754499-37754521 GCCCTGGTGCGTGAAAGCCGAGG - Intergenic
1147909986 17:43849591-43849613 GCCCAGGGGAGTGGGAGCCTTGG + Intronic
1148683463 17:49487514-49487536 TCCCTGGGGAGTCTGAGTCCCGG - Intergenic
1148786134 17:50147170-50147192 GGTCTGGGGCCTCTGAGCCCAGG - Intronic
1150327677 17:64269810-64269832 CTACTGGGGGGTGTGAGCCCAGG + Intergenic
1151692329 17:75694225-75694247 GCCCTGGGGGTTCTGAGCCCAGG + Intronic
1151932726 17:77242575-77242597 GCCGTGGGGCGCGTGAACCATGG + Intergenic
1152305735 17:79519262-79519284 TCTGTGGGGAGTGTGAGCCCTGG - Intergenic
1152344361 17:79742307-79742329 TCCCTGGGGCTTGTGAAGCCTGG - Intergenic
1152369629 17:79878301-79878323 GCCCTGGGGCTGGGGAGCGCTGG - Intergenic
1152386734 17:79979308-79979330 TCCCTGGAGCGTGTGTGCTCTGG - Intronic
1152447905 17:80356475-80356497 GCCCTGGGGCAGGTGAGCTGAGG - Intronic
1152526860 17:80893232-80893254 GCGCCGGGGCGTGTGTGCCAGGG + Intronic
1152561048 17:81078958-81078980 GACCTGGGGGGAGTGAGACCAGG + Intronic
1152794063 17:82298297-82298319 GCCCTGGGGACTGTGAGCAGTGG + Intergenic
1160344428 18:78121191-78121213 CCCCTATGGCGTATGAGCCCTGG - Intergenic
1160821780 19:1062347-1062369 GGCCTGGGTCGGGTGGGCCCTGG - Intronic
1160830523 19:1102775-1102797 GCCCCTGGGGGTGGGAGCCCAGG + Intergenic
1160930798 19:1568600-1568622 GCCCTGGGGCGCGCGAGGCAGGG - Intergenic
1161160861 19:2761266-2761288 GACATGGGGCGGGTGAGGCCAGG + Intronic
1161482301 19:4517173-4517195 CCCCTGGGCTGTGTGACCCCAGG + Intronic
1161513573 19:4684591-4684613 GCCCTGGGCCGTGTGGGTGCAGG - Intronic
1161627271 19:5334609-5334631 GCCCTGGGGTGTGTGTGTGCGGG + Intronic
1161939827 19:7395319-7395341 GGCCTGGGGCGCGGGACCCCCGG + Intronic
1162377825 19:10315694-10315716 GCCCGGGGACGTGTGAGTGCAGG - Exonic
1162588835 19:11577746-11577768 CCCTTGGGTCATGTGAGCCCTGG + Intronic
1163405430 19:17119144-17119166 GCCCTGGGGCGTGAGAGATCAGG - Intronic
1163694561 19:18757391-18757413 GCCCTGGGGAGGGGGTGCCCAGG - Intronic
1163713186 19:18859155-18859177 GCTCTGGGGTGTCTGAGCACTGG + Intronic
1164587379 19:29484450-29484472 TCCCTGGGGCCTGGGAGCTCAGG + Intergenic
1164591493 19:29510030-29510052 GCACTGGAGCATTTGAGCCCAGG - Intergenic
1164918626 19:32071977-32071999 GCCCTGGTGCCTCTGAGCTCAGG + Intergenic
1165741143 19:38206010-38206032 TCCCTGAGGCCTGTGAGCCCTGG - Intronic
1166248316 19:41546683-41546705 ACCCTGGGGCTCCTGAGCCCTGG + Intergenic
1167040891 19:47021807-47021829 GCCCTGGGGGCTGAGAGCCGCGG + Exonic
1167085998 19:47310065-47310087 GCCCTGGAGTGTGAGAGCCTGGG - Intronic
925070669 2:964928-964950 GCCCTGGGGCTCCTGTGCCCTGG + Intronic
925087072 2:1116716-1116738 GCCCTGGTGTGTGCGTGCCCTGG + Intronic
925087126 2:1116924-1116946 GCCCTGGCGTGTGGGTGCCCTGG + Intronic
927562532 2:24084162-24084184 GCCCCGGCGCGGCTGAGCCCTGG + Intronic
927720788 2:25380752-25380774 GCCCTGGGGCCTGGAGGCCCGGG + Intronic
932457385 2:71858209-71858231 GCCCTGGGGGGTGGGAGCAAAGG - Intergenic
932478320 2:72022991-72023013 GCCCTGCTGCGTGTGAGGCCTGG - Intergenic
934474695 2:94586540-94586562 GCCCAGCGGCGTGGGAGCTCTGG - Intergenic
935305649 2:101733762-101733784 GCCCTGGAGCCAGAGAGCCCTGG - Intronic
937650188 2:124310871-124310893 GCCCTGGGGCTGCTGAGCGCTGG - Intronic
938114691 2:128595125-128595147 GCCGTGGGGAGTTTGAGCACAGG - Intergenic
938116928 2:128608488-128608510 GCCCTCGGGCGAGTGTGGCCAGG + Intergenic
938727658 2:134121346-134121368 GCAAGGGGGTGTGTGAGCCCAGG + Intronic
942678849 2:178455542-178455564 GCCCTGGGACCTGTGTGCCTGGG - Intronic
948046274 2:234947733-234947755 GCCCCAGGGAGTGAGAGCCCTGG - Intergenic
948073995 2:235150924-235150946 GCCCTGGGGTGTGTCCTCCCAGG + Intergenic
948217375 2:236241685-236241707 GACCAGGGGCATGTGAGCACTGG + Intronic
1168765793 20:381113-381135 GCCCTGGAGGCTCTGAGCCCCGG + Exonic
1168765990 20:381738-381760 GCCCTGGAGCGGGGGAGCCGAGG + Intronic
1168811648 20:708699-708721 ACCCTGGGGAGTGTGACCTCAGG - Intergenic
1172200795 20:33124756-33124778 GCTCTGGGGAGTGTGGGCCTGGG - Intergenic
1175247547 20:57590956-57590978 GCCTTGGGGTCTGTGATCCCAGG - Intergenic
1175384290 20:58584310-58584332 GCCCTGGGCTGTGTGACCTCAGG + Intergenic
1175537527 20:59725317-59725339 GCTCAGGTGGGTGTGAGCCCAGG + Intronic
1175551508 20:59820865-59820887 GCCATGGGCTGAGTGAGCCCAGG + Intronic
1175800971 20:61800830-61800852 ACCCTGGGGCGTGTAACCTCTGG + Intronic
1175876409 20:62232291-62232313 GCCCTGGGACATGGGACCCCTGG + Intronic
1175911385 20:62406971-62406993 GCCCTGGGGCGCGGGGGTCCTGG + Exonic
1176009628 20:62885998-62886020 GCCCCGTGGTGTGTGAGCCCTGG + Intronic
1179455364 21:41495823-41495845 GCCCTGGGGTGGGTTTGCCCTGG - Intronic
1180050208 21:45327639-45327661 GGCCTGGGGTGTGAGAGTCCAGG + Intergenic
1180100106 21:45579887-45579909 GCCCTGGGACGCGGGTGCCCCGG + Intergenic
1180137263 21:45869718-45869740 GGCCTGGGGAGTGTGACCCCAGG + Intronic
1180618067 22:17141401-17141423 GCCCTGGGCCTTGTGCACCCAGG - Intronic
1182281063 22:29217933-29217955 GCCCTGGGTCCTGTTGGCCCTGG - Intronic
1183955215 22:41375986-41376008 GGCCTGGGACGTGTGAGAGCAGG - Intronic
1184810466 22:46828032-46828054 TCCCTGGGGCGTGAAAGTCCTGG - Intronic
1184864044 22:47192715-47192737 ATCCTGTGGCGTCTGAGCCCTGG + Intergenic
1185040542 22:48501628-48501650 TCCCTGGGGCCCGTGAGGCCTGG - Intronic
1185248092 22:49784071-49784093 GTGCTGGGGCGTGAGAGCGCGGG - Intronic
1185248119 22:49784235-49784257 GTGCTGGGGCGTGAGAGCGCGGG - Intronic
1185326715 22:50229174-50229196 GCCCTGGGCTGTGTGGGCCCTGG - Intronic
950722866 3:14897418-14897440 CCCCTGGGGCTTTGGAGCCCTGG - Intronic
953436279 3:42880607-42880629 ACCCTGGGGCCAATGAGCCCAGG + Intronic
954909242 3:54088742-54088764 GCCCTTTGTCCTGTGAGCCCTGG - Intergenic
961414166 3:126745297-126745319 TACCTGGGGCATCTGAGCCCAGG - Intronic
961873272 3:130003072-130003094 GAGCTGGGGCGTCTGAGCGCGGG + Intergenic
962526319 3:136241041-136241063 GCCGAGGGTCGTGTGAGCCCAGG - Intergenic
962977239 3:140456327-140456349 GCCCTAGGCAGAGTGAGCCCAGG - Intronic
963038566 3:141052164-141052186 GCCCTGGGGCGTTTGGGGCCCGG + Intronic
963091558 3:141487450-141487472 GGCCTGGGGTGGGAGAGCCCGGG + Intronic
967993648 3:195150624-195150646 GCCGTGTGCTGTGTGAGCCCCGG - Intronic
969016578 4:4107563-4107585 GAGCTGGGGCGTCTGAGCGCGGG + Intergenic
969252693 4:5980118-5980140 GCCCCGGGGTGTGGGAGCCCTGG + Intronic
969418580 4:7076709-7076731 GCACTAGGGCGTGTGATGCCTGG - Intergenic
969703536 4:8780414-8780436 GCCCTTGGGGGTGTGGGCCTGGG + Intergenic
972670959 4:41214031-41214053 GGCCTGGGGCGGGGGAGACCGGG - Intronic
973537205 4:51895388-51895410 TCCCTAGGGCCTGTGAGCCTGGG + Intronic
976276491 4:83284273-83284295 GCCCTGGGGCGAGTCACCTCAGG - Intronic
980134459 4:128846486-128846508 GTCCAGGTGCCTGTGAGCCCGGG + Exonic
985529140 5:423745-423767 GACCTGGCGCGTGAGAGCCGTGG + Intronic
985611786 5:893223-893245 GCCCGGCGGCCTGTGCGCCCGGG - Intronic
985661591 5:1159935-1159957 GCCCAGGTGCGGGTGACCCCTGG - Intergenic
985764131 5:1768037-1768059 GCCCTGGGCTGAGGGAGCCCTGG + Intergenic
985864252 5:2501030-2501052 GCCCTGGGTCGTGGGACCCCTGG - Intergenic
986055803 5:4135763-4135785 GACGTTGGGAGTGTGAGCCCTGG + Intergenic
992219730 5:74560054-74560076 GACCTGGAGCGTGTGCCCCCAGG + Intergenic
995365943 5:111360490-111360512 GCCAAGGGGCTTGTGACCCCTGG - Intronic
997634126 5:135392006-135392028 GGCCTGAGGCATGTGAGCCAGGG - Intronic
999133401 5:149301242-149301264 GCCCTGAGGTGTGGGAACCCAGG - Intronic
999916958 5:156273193-156273215 GCCCTGGGGCTTGTAATCCTAGG - Intronic
1002614092 5:180439586-180439608 GCCCTGGGGCCTGTCAGTACCGG + Intergenic
1010165761 6:72913446-72913468 GGCATGGGGTGTGTGAGTCCTGG + Intronic
1013521773 6:110940029-110940051 GCCCAGGGGAGTTTGAGCCCAGG - Intergenic
1015994903 6:138987805-138987827 CACCTGGCGCGTGTGAGGCCGGG - Exonic
1018652306 6:166002592-166002614 GTCCTGGGTCCTGGGAGCCCGGG - Intergenic
1018962672 6:168459536-168459558 GCCCCAGGGTGGGTGAGCCCTGG + Intronic
1018962680 6:168459552-168459574 GCCCTGGGGTGGGTGAGCCCTGG + Intronic
1018962686 6:168459568-168459590 GCCCTGGGGTGGATGAGCCCTGG + Intronic
1018962693 6:168459584-168459606 GCCCTGGGGTGGGTGAGCACTGG + Intronic
1018962700 6:168459600-168459622 GCACTGGGGTGGGTGAGCCCTGG + Intronic
1018962707 6:168459616-168459638 GCCCTGGGGTGGGTGGGCCCTGG + Intronic
1018962716 6:168459632-168459654 GCCCTGGGGTGGGTGAGCTGGGG + Intronic
1018962724 6:168459662-168459684 GCACTGGAGTGGGTGAGCCCTGG + Intronic
1018962729 6:168459678-168459700 GCCCTGGGGTGGGTGAGCCCTGG + Intronic
1018962737 6:168459694-168459716 GCCCTGGGGTGGGTGAGCCAGGG + Intronic
1018962751 6:168459740-168459762 GCCTTGTGGTGGGTGAGCCCTGG + Intronic
1018962759 6:168459756-168459778 GCCCTGGGGTGGGTGAGCCGGGG + Intronic
1018962767 6:168459785-168459807 GCCCTCTGGTGGGTGAGCCCCGG + Intronic
1018962773 6:168459801-168459823 GCCCCGGGCTGGGTGAGCCCTGG + Intronic
1018962783 6:168459817-168459839 GCCCTGGGGTGGGTGAGCCGGGG + Intronic
1018962793 6:168459846-168459868 GCCCTGGGCTGGGTGAGCCCGGG + Intronic
1018971372 6:168531670-168531692 GCCCTGGCGAATGTGAGCCATGG - Intronic
1019140306 6:169938456-169938478 GCCCTGGGGAGGGAGAGCCTGGG + Intergenic
1019411331 7:908081-908103 GCCATGTGGCCTGGGAGCCCCGG + Intronic
1019414324 7:920409-920431 GCCCAGGGGCGTGTGACTCGGGG - Intronic
1019446876 7:1075972-1075994 GCCCTGGAGAGTGGCAGCCCCGG - Intronic
1019557492 7:1639972-1639994 GCCGTGGGGCTGGGGAGCCCGGG - Intergenic
1019558651 7:1645156-1645178 GTCCTGGGGTGAGGGAGCCCTGG - Intergenic
1019937612 7:4266776-4266798 GCCCACTGGCGTGTGTGCCCCGG + Exonic
1021868209 7:24979658-24979680 GTCCTGGGGTGGGTGAGACCCGG + Intronic
1023015949 7:35968765-35968787 GCCCTGGGCCGCCTGAGGCCTGG + Intergenic
1023203145 7:37720253-37720275 GCCCTGTGCCCTGTGAACCCAGG - Intronic
1023820790 7:43979504-43979526 TCTCTGGGGCCTGTGAGTCCAGG - Intergenic
1026443139 7:70460949-70460971 GACCTGGCAGGTGTGAGCCCTGG + Intronic
1028446838 7:90934139-90934161 GCCTTGGGGCGTGAGAGCAGTGG + Intronic
1029075044 7:97928362-97928384 GAGCTGGGGCGTCTGAGCGCGGG + Intergenic
1029088631 7:98031360-98031382 AGCCTGGGCAGTGTGAGCCCCGG + Intergenic
1029889263 7:103909228-103909250 GCCCTGGGGAGTATGGGCCTTGG + Intronic
1031986554 7:128167722-128167744 GCGCGGGGGCGCGGGAGCCCCGG + Intergenic
1032020584 7:128405477-128405499 GCCCTCGGGCGTGTGGGAACTGG - Intronic
1032709547 7:134450072-134450094 GCCTTGGGCCCTGTGAGTCCTGG - Intronic
1033112865 7:138597881-138597903 GTCCTGGGTGGTGTGAGACCCGG + Intronic
1035567456 8:650866-650888 GCCCTGGAGTGTGTTATCCCAGG + Intronic
1036242480 8:7092016-7092038 GAGCTGGGGCGTCTGAGCGCGGG - Intergenic
1036258313 8:7221995-7222017 GAGCTGGGGCGTCTGAGCGCGGG + Intergenic
1036259374 8:7228139-7228161 GAGCTGGGGCGTCTGAGCGCGGG + Intergenic
1036307252 8:7611385-7611407 GAGCTGGGGCGTCTGAGCACGGG - Intergenic
1036310367 8:7680591-7680613 GAGCTGGGGCGTCTGAGCGCGGG + Intergenic
1036311416 8:7686709-7686731 GAGCTGGGGCGTCTGAGCACGGG + Intergenic
1036358094 8:8059372-8059394 GAGCTGGGGCGTCTGAGCACGGG - Intergenic
1036359172 8:8065512-8065534 GAGCTGGGGCGTCTGAGCGCGGG - Intergenic
1036761144 8:11509289-11509311 GGCCTGGGGCTTGGCAGCCCAGG + Intronic
1036891786 8:12601440-12601462 GAGCTGGGGCGTCTGAGCGCGGG + Intergenic
1036892853 8:12607574-12607596 GAGCTGGGGCGTCTGAGCGCGGG + Intergenic
1037844979 8:22275304-22275326 GCCCTGGAGCATGTGGGCCCCGG + Exonic
1038401298 8:27286889-27286911 GGCCTGGGGTGTGACAGCCCTGG - Exonic
1039060125 8:33566449-33566471 GGCCGGGGGCGTGGGAGCCGAGG - Intronic
1039873518 8:41567003-41567025 ACCGTGGGGTGTGCGAGCCCGGG + Intergenic
1042591584 8:70402992-70403014 GCCCGGGCCCGTGTCAGCCCCGG - Intronic
1045425554 8:102062513-102062535 ACCCTGGAGCATGTGAGCACAGG - Intronic
1048293653 8:133198838-133198860 GCCCTGGGGCCTGAGGGCACAGG - Intronic
1049004840 8:139847962-139847984 GCCCTGGGGCACGTGGGGCCTGG + Intronic
1049197678 8:141324574-141324596 GCCCTGGGGCTTCTGAGCTGAGG - Intergenic
1049542718 8:143215757-143215779 GTCCTGGGGCGTGGCAGCCGAGG - Intergenic
1049555025 8:143277403-143277425 GCCCTGGGGTGTGGGGGCCCAGG + Intergenic
1049651677 8:143772504-143772526 GCCCCGGGAGGTGTGAGCCCCGG + Intergenic
1049651691 8:143772536-143772558 GCCTCGGGAGGTGTGAGCCCCGG + Intergenic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1052673775 9:31592994-31593016 GCCCTGGGGCATGGGTGCCAGGG - Intergenic
1053443233 9:38132539-38132561 GCCCTGGGGCTTCAGAGCACTGG - Intergenic
1053933347 9:43127876-43127898 GCCCAGCGGCGTGGGAGCTCCGG + Intergenic
1054394488 9:64639564-64639586 GCCCAGCGGCGTGGGAGCTCCGG + Intergenic
1054429137 9:65144763-65144785 GCCCAGCGGCGTGGGAGCTCCGG + Intergenic
1056817599 9:89812808-89812830 GCCCTGGAGCTTGTGTGACCAGG - Intergenic
1057076688 9:92141740-92141762 GCCCTGGGGCGTGGGCATCCCGG + Intergenic
1057272198 9:93657626-93657648 GTCCTGGTGCGTCAGAGCCCTGG + Intronic
1060214267 9:121729199-121729221 GCTCTTGGCTGTGTGAGCCCAGG - Intronic
1060819825 9:126654906-126654928 GGCCTGGGGGCTGGGAGCCCAGG - Intronic
1061580572 9:131533269-131533291 GGCCTGAGCCGTGTGGGCCCGGG - Intergenic
1061921162 9:133783359-133783381 GCTCTGGGGCACGTGAGCACTGG + Intronic
1062023140 9:134328534-134328556 GCCCTGGGGCGTGGGCTGCCTGG - Intronic
1062032043 9:134366135-134366157 GCCCTGGTGCCTCTGAGCCTTGG - Intronic
1062346084 9:136115945-136115967 GCCCTGGGCCGCCTGAGGCCTGG - Exonic
1062394879 9:136348756-136348778 CCCCTGGAGCGGGTGAGCCAGGG + Exonic
1062447632 9:136602277-136602299 GCACTGGGGCGGGTGGACCCGGG - Intergenic
1062571614 9:137188405-137188427 GCGCTGGGGCTGGTGAGGCCTGG - Exonic
1192624614 X:72714348-72714370 GCCCCGGGGCGGGCGAGCCCCGG - Intergenic
1195093487 X:101485537-101485559 GCCCTGGGGCCCGCGCGCCCTGG + Intronic
1195285142 X:103376620-103376642 GCTCCGGGGCCCGTGAGCCCCGG + Intronic
1199601053 X:149541280-149541302 GCCCTGGCACCTGTCAGCCCCGG - Exonic
1200179780 X:154143373-154143395 GCGCTGGGGCGGGTGGGCCGTGG + Intergenic
1200796794 Y:7348323-7348345 GCACTGGGGCGTGTGAGGGTTGG - Intergenic