ID: 1130897934

View in Genome Browser
Species Human (GRCh38)
Location 15:88184983-88185005
Sequence CTGAAGTCTCAGATGAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130897934 Original CRISPR CTGAAGTCTCAGATGAAGCT AGG (reversed) Intronic
900306346 1:2010734-2010756 CTGAGGTTTCAGAAGAATCTGGG - Intergenic
900833805 1:4984844-4984866 CAGAACTCACAGATGCAGCTTGG - Intergenic
901951209 1:12748381-12748403 CTGAAGTCGAAGAAGAAGCAGGG + Intronic
902881730 1:19376016-19376038 CAGAAGTCCAAGATGAAACTGGG + Intronic
904740113 1:32667767-32667789 CTGAAGTCTCTGATACAGCATGG + Intronic
905548003 1:38815563-38815585 CTGAAGTCACAGCTGAGACTTGG + Intergenic
906780287 1:48567323-48567345 CTGGGGTCCCAGAGGAAGCTGGG + Intronic
907142168 1:52197697-52197719 CTAAAATGTCAGATGAAGTTAGG + Intronic
907181895 1:52578117-52578139 CTGTAGTCTCAGCTGAACCTGGG + Intergenic
909363047 1:74787582-74787604 CAAAAATCTTAGATGAAGCTTGG - Intergenic
910012370 1:82481212-82481234 CTGAAGTCACAGGTAAGGCTGGG + Intergenic
911007958 1:93247529-93247551 CTCAAGTCTCTGAAGTAGCTGGG + Intronic
911706032 1:101014498-101014520 CTGAAGGCTCAGATGATTGTTGG - Intronic
911818977 1:102391943-102391965 CAGAAGTCCCAGATCAACCTGGG + Intergenic
912080555 1:105931402-105931424 ATGTAGTCTCAGATAAAGATAGG + Intergenic
914720628 1:150285851-150285873 CTGTAGTCCCAGCTGAGGCTGGG + Intronic
915791280 1:158674335-158674357 ATGAAGCCTCTGATGAAGTTCGG - Exonic
917801772 1:178577917-178577939 CAGAAGTCTCAGAGTAAGCTCGG - Intergenic
921252911 1:213314035-213314057 CTGGAGTCTCGGAGGAAGCAGGG - Intergenic
922115516 1:222609071-222609093 CAGAAGGCTCAGAAGAAGATAGG - Intergenic
922672215 1:227519175-227519197 CTGTGTTCTCAGCTGAAGCTGGG + Intergenic
922977979 1:229800984-229801006 CTGAAGTCTCCTCAGAAGCTGGG + Intergenic
923066052 1:230518342-230518364 CTGAAGCCTCCCATGGAGCTGGG + Intergenic
924822169 1:247503801-247503823 CTGTGTTCTCAGCTGAAGCTGGG + Intergenic
1063200118 10:3779718-3779740 CTGAAGACACTGATGAGGCTTGG - Intronic
1063767723 10:9161241-9161263 CTTGAGTCTCAGATGAGACTTGG + Intergenic
1064097700 10:12436136-12436158 CTTGAGTCACAGATGAAGCCGGG - Intronic
1064923445 10:20543529-20543551 CTGAAGTCACAGCTGAAACTGGG + Intergenic
1065700224 10:28417894-28417916 CTGAAGGCTCAGATGATCATTGG + Intergenic
1066215144 10:33279312-33279334 CTGCAGTCTCATCCGAAGCTGGG + Intronic
1067264850 10:44732017-44732039 GTGAAGTCACAGCTGAACCTAGG - Intergenic
1067300467 10:45003497-45003519 CAGTAGACTCAGAAGAAGCTTGG + Exonic
1069830600 10:71280103-71280125 GTGAAGTCTCACATGGAGCTAGG - Intronic
1071662823 10:87522627-87522649 CTGAAGGCTCAGATGATCATGGG - Intronic
1072254490 10:93608287-93608309 CTGTAGTCTCAGCTGAGACTGGG - Intergenic
1075315876 10:121453063-121453085 ATGAAGGCTCAGAAGAAGCAGGG + Intergenic
1077300195 11:1843172-1843194 CTCAGGTCTCAGCTGAGGCTTGG - Intergenic
1079381043 11:19937708-19937730 TTTAAGTCTCAGAAGATGCTAGG - Intronic
1079844304 11:25445626-25445648 CTGAAGCCTGAGAAGGAGCTCGG + Intergenic
1080177853 11:29388322-29388344 TTGCAATCTCAGGTGAAGCTTGG - Intergenic
1081094245 11:38912281-38912303 CTGAAGGCTCAGATGATTGTAGG + Intergenic
1081384571 11:42456478-42456500 CTCAAGTTTCAGAGCAAGCTTGG + Intergenic
1081589841 11:44414363-44414385 CTGTAGTCTCATCAGAAGCTTGG + Intergenic
1082125625 11:48428414-48428436 GAGAAGTCACAGATGAAACTTGG - Intergenic
1082137702 11:48568424-48568446 CTGACTCCTCAGAAGAAGCTTGG - Intergenic
1082250798 11:49977796-49977818 GAGAAGTCACAGATGAAACTTGG + Intergenic
1082559240 11:54599444-54599466 GAGAAGTCACAGATGAAACTTGG - Intergenic
1083126129 11:60567708-60567730 CTGAAGTCTCAGATGATCACTGG + Intergenic
1083568049 11:63737127-63737149 CGGAATTCTAAGATGGAGCTGGG - Intronic
1086958540 11:92958682-92958704 CAGAAGTATCACTTGAAGCTAGG - Intergenic
1088122993 11:106391558-106391580 CTGAAGTCACAGCAGAATCTTGG - Intergenic
1088856150 11:113755856-113755878 CTGAAGGCTCAGATGATCGTTGG + Intronic
1090175231 11:124642968-124642990 CTGGAGTCTCATCTGAGGCTTGG - Intronic
1093090769 12:14917753-14917775 CTGAAGGCTCAACTGGAGCTGGG - Intronic
1093174993 12:15903155-15903177 CTCAAGTGTCAGATGAAGGGAGG + Exonic
1093658450 12:21724772-21724794 CTGATTTCTCTGATGGAGCTGGG + Intronic
1094620135 12:32072981-32073003 CAGAAGTCTGAGATCAAGGTTGG + Intergenic
1094812387 12:34151283-34151305 CTGTGTTCTCAGCTGAAGCTGGG - Intergenic
1095460341 12:42436919-42436941 CTGAAATCTCAGATAAAGTGGGG + Intronic
1095865934 12:46972096-46972118 CCCAAGTCTCAGATGAAACCAGG + Intergenic
1096347633 12:50864273-50864295 TTGAAGCCTTAGATGAAGTTGGG - Intronic
1098256854 12:68625624-68625646 TTAAAGTTTCAGATGAGGCTGGG + Intronic
1099028568 12:77496074-77496096 CTGAAGTGTTAGATCCAGCTGGG + Intergenic
1099198205 12:79644728-79644750 CTGAAGTCTAAACTGAAACTAGG + Intronic
1099426806 12:82533483-82533505 CAAAAGTATCAGATCAAGCTTGG - Intergenic
1100322188 12:93506221-93506243 TTGAAGACTCAGAAGAGGCTGGG - Exonic
1100575679 12:95889812-95889834 CTGAAGTCTGGGATCAAGTTGGG - Intronic
1102343660 12:112143846-112143868 CTTCAGTCTCCGATGTAGCTGGG + Intronic
1102674528 12:114648072-114648094 CTGAAGCCTCACTTGAACCTGGG - Intergenic
1103232600 12:119344403-119344425 CAGAGGTCATAGATGAAGCTTGG - Intronic
1103284113 12:119785873-119785895 CAGAAGTCTAAGATGATGCCAGG - Intronic
1104049911 12:125187806-125187828 CTAAAGGCTCAGATGAACCCCGG + Intronic
1106714246 13:32371925-32371947 CTGAAGGCTCAGATGATCATTGG - Intronic
1108000636 13:45902669-45902691 CTTAATACTCAGATGGAGCTGGG - Intergenic
1108969145 13:56349895-56349917 CTGCATTCTCATCTGAAGCTGGG - Intergenic
1109003432 13:56836111-56836133 AGGAGGTCTCAGATGAAGATGGG - Intergenic
1109286410 13:60413988-60414010 CTTAAGTCTCAGCTGAAGGGAGG + Intronic
1109511465 13:63380288-63380310 CTGAATTATTAGATGAAGATTGG + Intergenic
1110812406 13:79825466-79825488 CAGAAGGCTCAGAGGAATCTTGG - Intergenic
1112364177 13:98742568-98742590 CGGAAGTCTGAGATGGAGGTCGG + Intronic
1114515645 14:23298178-23298200 TTCGAGTCACAGATGAAGCTCGG + Exonic
1117054758 14:51900540-51900562 CTACAGTGTCAGATGAACCTAGG + Intronic
1117222745 14:53621842-53621864 CTGAAAGCTCAGATGAAGTGAGG - Intergenic
1117545717 14:56793863-56793885 TTGAAGTCTAAGATGAAATTGGG - Intergenic
1118235225 14:63997107-63997129 CTGCAGTGTCATATGAATCTCGG - Exonic
1118393512 14:65316316-65316338 CTGCAGTCTCATCAGAAGCTTGG - Intergenic
1118862436 14:69674890-69674912 CTGAAGTCTCTGTTGAAACAGGG + Intronic
1120060052 14:79971649-79971671 CTTTAGCCTCAAATGAAGCTTGG + Intergenic
1120244361 14:81989097-81989119 CTGAAAGCTCAGATGATGGTCGG + Intergenic
1121858137 14:97289531-97289553 CTCAAGTCTTAGAATAAGCTAGG + Intergenic
1121910526 14:97787166-97787188 CTGAAGGCTCAGATGATCCTTGG + Intergenic
1121998709 14:98628032-98628054 CTAAAGTCTCAGAGGGAGCATGG + Intergenic
1123985663 15:25643961-25643983 ATGAAATCTCAGAAGAAGCTAGG + Intergenic
1125276172 15:37994621-37994643 CTGAAGTGTGATAGGAAGCTGGG - Intergenic
1126798247 15:52277766-52277788 CTGATGACTCTGAAGAAGCTCGG + Intronic
1129763550 15:78146698-78146720 CAGAAGTCTCAGATGGAAGTTGG - Intronic
1130860809 15:87887875-87887897 CCCAAGTCACAGATGAAGATAGG + Intronic
1130897934 15:88184983-88185005 CTGAAGTCTCAGATGAAGCTAGG - Intronic
1133050797 16:3116163-3116185 CCGAGGTCTCAGCTGAGGCTGGG + Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1137301017 16:47147365-47147387 CTAAAGTCTCAGATCAAGGCAGG - Intergenic
1138045540 16:53720286-53720308 ATGACATCTCAGATGAAGCAGGG - Intronic
1139385806 16:66569461-66569483 CTAAATTCTCAGATGTAGTTCGG - Intronic
1141409514 16:83822930-83822952 CAGAAGCCTCAGATGAATTTTGG - Intergenic
1141717180 16:85733759-85733781 CTGGAGTCTCAGAGGAAGCCAGG + Intronic
1142682126 17:1556314-1556336 CTGAAGTCTAAGCAGAAGCTTGG - Intronic
1142915592 17:3133876-3133898 CTGGAGTCTCAGAAGAATTTTGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147246348 17:39123669-39123691 CTGACGTTTCAGATGGAGCTGGG - Intronic
1149322801 17:55498619-55498641 CAGGAGTCTGAGATGAGGCTAGG - Intergenic
1151517148 17:74604007-74604029 CTGCTGTCCCAGGTGAAGCTGGG - Intergenic
1152431771 17:80252222-80252244 CTGAGGTCACAGCTGAAGCTGGG + Intronic
1152534806 17:80944340-80944362 CTAAAGTTTCAGAATAAGCTCGG - Intronic
1154248626 18:12723099-12723121 CGGAAGTCTCAGATGATACCAGG - Intronic
1155106529 18:22671828-22671850 ATGAATTCTCAGATGAACTTTGG - Intergenic
1156386673 18:36611405-36611427 CTGAAGTCTCATCTGAGACTTGG + Intronic
1157759412 18:50249423-50249445 CTGAAGTATCAGTTGAGCCTGGG + Intronic
1158036168 18:53033314-53033336 GTTAAGTCTCACTTGAAGCTGGG - Intronic
1158502620 18:58017195-58017217 TTGAGGCCTCAGATGAAGGTGGG + Intergenic
1158765905 18:60449112-60449134 CTGAAGTCTCAGATGGAAATTGG - Intergenic
1159514322 18:69437988-69438010 CTGAAGTCTCAGATGATCATTGG - Intronic
1160111313 18:76034450-76034472 CTGAAGTCTCAGATGGGGTGGGG - Intergenic
1162838009 19:13334186-13334208 AAGAAGTCTAAGATGAAGCCAGG - Intronic
1164793643 19:31008795-31008817 CTGGAGTTTCAGATCAGGCTGGG - Intergenic
1167193478 19:48008838-48008860 CAAAAATCTCAGAAGAAGCTGGG + Intronic
1167519882 19:49948120-49948142 CTGAAGTCTCAGCTGACGCTGGG - Intronic
926448611 2:12974233-12974255 TTGAAGGCTCAGAAGAAGATAGG - Intergenic
926538377 2:14143168-14143190 GGGAAGACTCTGATGAAGCTGGG + Intergenic
927182467 2:20456320-20456342 TTCAAGTGTCAGAGGAAGCTGGG + Intergenic
930202699 2:48560314-48560336 CTGAATTCTCAAAGGAAGCTGGG - Intronic
930701689 2:54464171-54464193 CTGAAATCTCACATGTAGCTTGG + Intronic
931017766 2:58005775-58005797 TGGAAGACCCAGATGAAGCTAGG + Intronic
931079353 2:58752134-58752156 TTGAGGTCTCAGAAGAAGATAGG + Intergenic
931717697 2:65042262-65042284 CAGAAGTCTAAGATCAACCTGGG + Intergenic
932211714 2:69937045-69937067 CTGAAGAGTCAGACGAAGCCAGG + Intronic
932726336 2:74182893-74182915 CTGTAGTCCCAGCTGAGGCTGGG + Intergenic
932950901 2:76291845-76291867 CTGAAGGCTCAGATGATCATTGG - Intergenic
933632937 2:84677062-84677084 CTGAAGTGTCTGATGAAGCGGGG - Exonic
934484608 2:94693207-94693229 TTGAAGTGTCAAATGAAGCCTGG - Intergenic
935460333 2:103323886-103323908 CTGAAGGCTCAGATGATCTTTGG + Intergenic
936636540 2:114265307-114265329 CTGTAGTCTCAGATAAACATGGG - Intergenic
937623525 2:124017546-124017568 TTGAAGTCTCAAATGCAACTTGG + Intergenic
939255078 2:139732871-139732893 CTGCAGGTTCAGATGAGGCTAGG - Intergenic
942192612 2:173485202-173485224 CACAAGTGTCAGATGAAGGTTGG - Intergenic
942303024 2:174580550-174580572 CTGTAGTCTAGGATGAATCTTGG + Intronic
945793582 2:214334361-214334383 CAGAAGGCTCAGAGGAATCTGGG + Intronic
946951650 2:224882466-224882488 CTAAAGTCTCTGAGAAAGCTGGG + Intronic
947012375 2:225580661-225580683 CTGAAGTCTCAGTTGATGGATGG + Intronic
1169387711 20:5165359-5165381 CTGAAGTGGCAGGTGTAGCTGGG - Intronic
1169488910 20:6055304-6055326 ATGAACTCTCAGATGGGGCTAGG - Intergenic
1169916504 20:10689093-10689115 ACTAAGTCTTAGATGAAGCTTGG + Intergenic
1170642948 20:18171988-18172010 CTGAAGGCTCAGATGATCATTGG + Intronic
1172926561 20:38542294-38542316 CTGAACTCACAGAAGATGCTGGG - Intronic
1173333137 20:42092275-42092297 CTAAAGCCTCAGCTGAAACTTGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175190289 20:57207362-57207384 CTGTAGTCACTGATGGAGCTAGG - Intronic
1175329744 20:58155369-58155391 GGGAAGCCTCAGGTGAAGCTGGG - Intronic
1175925780 20:62470719-62470741 CTGAAGCCTCGGCTGAAGCCTGG - Intronic
1177734250 21:25069258-25069280 CTTAAATCTATGATGAAGCTTGG + Intergenic
1178740902 21:35200216-35200238 CAGAAGTTTGAGATGAATCTGGG - Intronic
1179419390 21:41223432-41223454 CTGGAGTCTCAGAGGATGCATGG - Intronic
1179429016 21:41305727-41305749 TTGAAGTCTCAGATGAACGTTGG - Intronic
1179641795 21:42752558-42752580 CAAAAATCTCAGATGAGGCTGGG - Intronic
1182475146 22:30573154-30573176 CTGAAGTGTCAGGCGGAGCTGGG + Intronic
1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG + Intergenic
1185261937 22:49871598-49871620 CTGAAGGCTCAGATGACTGTTGG - Intronic
949474639 3:4431731-4431753 CTGAAGTCACAGACCAAGGTGGG + Intronic
950989007 3:17411180-17411202 CTGAAGGCTCAGATGATCCTTGG + Intronic
951661446 3:25071011-25071033 CTCAAGACTCAGAAGAAGCATGG - Intergenic
952003539 3:28813971-28813993 CTGAAGGCTCAGATGATTGTTGG - Intergenic
952480698 3:33758853-33758875 CTGAAGTGTCAAATGAATCAAGG + Intergenic
954019966 3:47730885-47730907 CTTAAGTCTCAGATGATTGTTGG - Intronic
955476106 3:59337820-59337842 GTGATGTCTGAGATGATGCTAGG + Intergenic
956180327 3:66511730-66511752 CTGAAGGCTCAGATGATCATTGG - Intergenic
956877372 3:73476828-73476850 CTGAAGGCTCAGCTGAGGGTCGG - Intronic
958434526 3:94080771-94080793 CAGCAGTCTCAGATCAACCTGGG - Intronic
962033776 3:131629327-131629349 CTGAAGGCTCAGATGATTATTGG + Intronic
963125890 3:141815848-141815870 CTGAAGGCTCAGCTGAGGCTGGG - Intronic
963453306 3:145513089-145513111 CTGAAGAGTCACATGAAACTAGG + Intergenic
964796123 3:160498729-160498751 CTGCAGTCTTATCTGAAGCTAGG - Exonic
965427305 3:168543064-168543086 CTGAAGTCTAGGATGAAGGGTGG - Intergenic
965571325 3:170176561-170176583 CTGAAGTCTGAGAACTAGCTAGG + Intronic
965953890 3:174344646-174344668 CTGAGGTCTCAGTTGGAGCATGG + Intergenic
967678881 3:192335716-192335738 CTGAAATCTCAGATCCAGCTGGG - Intronic
967717748 3:192782686-192782708 ATGAAGTCCCACATGAAGCAGGG - Intergenic
969435409 4:7186377-7186399 CTGATGCCTCAGAGGACGCTGGG + Intergenic
969674818 4:8608694-8608716 CTGAAGTCCCAGACCAGGCTGGG - Intronic
970225953 4:13856927-13856949 TTGAGGTCTCAGGTGAGGCTGGG + Intergenic
971716651 4:30186545-30186567 CTAAAGTCTTAGATGAAACATGG + Intergenic
971939695 4:33199195-33199217 TTGAGGGCTCAGAAGAAGCTAGG + Intergenic
973023208 4:45230714-45230736 CTGAAATGTTAAATGAAGCTAGG + Intergenic
973106817 4:46349052-46349074 CTGAAGGCTCAGATGATTGTTGG + Intronic
973756054 4:54074522-54074544 TTGAGTTCCCAGATGAAGCTGGG - Intronic
973938410 4:55876523-55876545 CTGAAAACTCAGACTAAGCTTGG - Intronic
973995835 4:56457501-56457523 TCGAAGTCTAAGAAGAAGCTAGG - Intronic
974530885 4:63106758-63106780 CTGAAGACTCGGATGACTCTTGG - Intergenic
974800112 4:66806070-66806092 CAGAAATCTCAGTTAAAGCTAGG - Intergenic
975655991 4:76641695-76641717 CTTATGTCCAAGATGAAGCTAGG - Intronic
977148677 4:93480729-93480751 CTGAAGTCTCAGATAACACTGGG - Intronic
978756958 4:112313111-112313133 CTGAAGTTTAAGGTGAAGTTTGG + Intronic
979792042 4:124796606-124796628 CTGAAGTCATAAATGAAGGTAGG + Intergenic
980663504 4:135898674-135898696 CAGAAGGCTCAGAAGAAGATAGG + Intergenic
981181755 4:141754272-141754294 CTCAAGTGTCACATGGAGCTGGG + Intergenic
982300573 4:153874876-153874898 CTGAAGACTCAGATGATAATTGG + Intergenic
985328987 4:188806178-188806200 ATGGAGTCTCAGATGAATCCCGG + Intergenic
986357871 5:6946694-6946716 CTGAAGTCTTAGCAAAAGCTGGG + Intergenic
987766657 5:22240624-22240646 CTGGAGAATCAGTTGAAGCTGGG - Intronic
988820754 5:34882537-34882559 CTAGAGCCTCACATGAAGCTTGG - Intronic
989767373 5:45103455-45103477 TGGAAGTCTCAGAAGAAGATGGG + Intergenic
990635873 5:57725655-57725677 CTGAAGTCTGTGAAGTAGCTAGG + Intergenic
992208327 5:74452600-74452622 CTGAAGCCTCAGTAAAAGCTGGG + Intergenic
994932556 5:106207695-106207717 CTGAAGTCTCAGGAGCAGCTCGG + Intergenic
995642970 5:114278608-114278630 CAGAAGTCTGAGATGGACCTGGG - Intergenic
997577092 5:134988197-134988219 CTGAAGGCTCAGATGATTGTTGG - Intronic
998199635 5:140108768-140108790 CTGACATCGCAGATGAAGCCGGG + Intronic
998690706 5:144584461-144584483 CTGAAGTGACAGATGCTGCTGGG - Intergenic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
1001199291 5:169701443-169701465 CTGAAGTCTCAGGTAAAGCATGG - Intronic
1002151142 5:177232013-177232035 CTTCAGTCTCACATGTAGCTGGG + Intronic
1004701673 6:18085397-18085419 CTGAAGTCTCAACTGGAGCGGGG - Intergenic
1004858114 6:19772036-19772058 CTGAAGTCTCAGATGATTGCTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1007202100 6:40118293-40118315 CCCAAGTCACAGATAAAGCTTGG - Intergenic
1008413829 6:51216003-51216025 ATTAAGTCTGAGATGAGGCTTGG + Intergenic
1008685390 6:53920664-53920686 ATGATGTCTCTGATGAAGCCTGG + Exonic
1009461246 6:63916237-63916259 CTGAAGGCTCAGATGATTGTTGG + Intronic
1011737184 6:90322849-90322871 CTGAAGGCTCAGATGATTGTTGG - Intergenic
1012267237 6:97160448-97160470 CTGACTTCTCAGAGGAAACTGGG - Intronic
1013179425 6:107705855-107705877 CTGAACCCTGAGATGAAGCAGGG - Intronic
1013448558 6:110256249-110256271 CTAAAGTCTGAGGTGAAGCTAGG - Intronic
1014698350 6:124652245-124652267 ATGAGGTCTCAGATGGAGATGGG - Intronic
1018164435 6:161079925-161079947 ATGAAGTCTGAGATGTAGCCTGG + Intronic
1018336770 6:162800103-162800125 TTGAAGTCTCTGATGACTCTCGG + Intronic
1019906514 7:4069118-4069140 CTCTAGCCTCAGATGAGGCTGGG + Intronic
1020727780 7:11837669-11837691 CTGAAGGCTCAGATGATCATAGG + Intergenic
1021119162 7:16778490-16778512 CTGCAGCCTCATCTGAAGCTTGG + Intronic
1021553995 7:21901165-21901187 CTGAAGGTCCAGATGTAGCTGGG - Exonic
1021732906 7:23613942-23613964 CTGAAGGCTCAGATGATTTTTGG - Intronic
1021783691 7:24132326-24132348 CTGAATTCTGACATGAAACTTGG - Intergenic
1021882814 7:25110788-25110810 CTGAAGTCTGAGCTGTACCTTGG - Intergenic
1023152478 7:37215101-37215123 CTGAAATCTGAAATGAATCTTGG - Intronic
1023250428 7:38254452-38254474 CTGAAGTTTCTGGTGAAACTTGG - Intergenic
1023251731 7:38270550-38270572 CTGAAGTTTCTGGTGAAACTTGG - Intergenic
1027121942 7:75528094-75528116 CTGAAGACTCACAGGAAGCGAGG + Intergenic
1028541162 7:91943856-91943878 ATGAAGTCTCAGATAAACTTTGG - Intronic
1029187767 7:98751968-98751990 CTCGAGTCTCAGATGCATCTGGG - Intergenic
1029420441 7:100469272-100469294 CTGGGGTCTCAGAGGAAGCGAGG + Intronic
1031941848 7:127797687-127797709 CTGAAGGCTCACAAGAAGTTGGG - Intronic
1033520265 7:142153495-142153517 CTGAAGTTTCAGAGGAAGCCAGG + Intronic
1034890546 7:154835350-154835372 CAGAAGTCCGAGATGAAGGTGGG - Intronic
1034974454 7:155439715-155439737 CTGAACTCTCCTCTGAAGCTCGG + Intergenic
1035009531 7:155701778-155701800 CAGAAGACTCAGTTGAACCTGGG - Intronic
1035180132 7:157083445-157083467 AGGAGGTCTCAGATGAAGATCGG + Intergenic
1035184252 7:157113424-157113446 CAGGAGTTTGAGATGAAGCTGGG + Intergenic
1037098782 8:15017619-15017641 CCGAAGTCTCCCATGTAGCTGGG + Intronic
1038585073 8:28780942-28780964 CTGAAGTCTCCGTGGATGCTGGG + Exonic
1040958718 8:53007766-53007788 CAGAAGTTCCAGATGAACCTGGG - Intergenic
1041013714 8:53570245-53570267 ATGAGGTCTCAGATGGAGATGGG + Intergenic
1043066006 8:75570745-75570767 CTCAAGTATCAGCTGAAGCATGG - Intergenic
1043785379 8:84391765-84391787 CTGAAGTCTCAGAATGAGCTAGG - Intronic
1045933512 8:107653988-107654010 CAGCAGTCTCAGATCAACCTGGG - Intergenic
1046514961 8:115246884-115246906 CTGAAGGCTCAGATGATCATTGG + Intergenic
1047565092 8:126035207-126035229 GTGAAGACACTGATGAAGCTGGG - Intergenic
1047785389 8:128149344-128149366 CTTGAGTTTCAGCTGAAGCTTGG + Intergenic
1048189203 8:132272949-132272971 CTGAAGTCTCATCTGAGGCAAGG + Intronic
1048399489 8:134051042-134051064 CTCAAGTGGCAGATGAATCTTGG - Intergenic
1048601640 8:135924499-135924521 ATCAAGTATCAGATGAAGGTGGG - Intergenic
1049119763 8:140724826-140724848 CTGAGGTTTGAGATGAAGCTAGG + Intronic
1049149976 8:141028504-141028526 CTTATTTATCAGATGAAGCTGGG + Intergenic
1049598189 8:143494221-143494243 AGGAAGTCTCTGTTGAAGCTGGG - Intronic
1050213047 9:3286473-3286495 CTGAAGACTCAGTTCAAGGTTGG - Intronic
1050929661 9:11307575-11307597 CTGAATGCTAAGATGAAGCTGGG - Intergenic
1052114026 9:24626803-24626825 CTGATGTCTGAACTGAAGCTGGG - Intergenic
1052306518 9:27016156-27016178 CTAGAGTCTCAGAGGAAGCATGG - Intronic
1052602810 9:30659179-30659201 CTGAAGTCTTACATGATGCTAGG - Intergenic
1053370686 9:37559212-37559234 TGGAGGTCTGAGATGAAGCTAGG - Intronic
1053673183 9:40391183-40391205 TTGAAGTGTCAAATGAAGCCTGG + Intergenic
1053922993 9:43017549-43017571 TTGAAGTGTCAAATGAAGCCTGG + Intergenic
1054384287 9:64531249-64531271 TTGAAGTGTCAAATGAAGCCTGG + Intergenic
1054511444 9:65985100-65985122 TTGAAGTGTCAAATGAAGCCTGG - Intergenic
1056273793 9:84973009-84973031 TTGAAAGCTCAGATGAAGTTTGG - Intronic
1056675575 9:88674087-88674109 CAGGGGTCTCAGCTGAAGCTTGG + Intergenic
1057523849 9:95782866-95782888 CACAAGTCTCAGAAGATGCTTGG + Intergenic
1059699090 9:116757808-116757830 CTGAAGGCTCAGAAGATGATTGG - Intronic
1059821305 9:117975699-117975721 CTGAAGTTTCAGAAAAAGCAAGG - Intergenic
1060092128 9:120752621-120752643 CTAAAATGTCAGCTGAAGCTGGG - Intronic
1060509616 9:124222399-124222421 TTGAAGTGACAGATGAAGCTAGG - Intergenic
1060618643 9:125043367-125043389 TTGAAGTCTCAAATGCAGTTTGG - Intronic
1061224683 9:129274049-129274071 GTGCAGTCAGAGATGAAGCTGGG - Intergenic
1186075526 X:5874459-5874481 CTGAAGTCTCACCTGAAGACAGG + Intronic
1188504098 X:30862560-30862582 CTGAAGGCTCTGACAAAGCTAGG - Intronic
1189350521 X:40272322-40272344 CAGAAATCTCAGATAAGGCTGGG - Intergenic
1189594465 X:42549236-42549258 ATGAAGTCTCAGATGAAAACGGG - Intergenic
1189862946 X:45292008-45292030 CTGAATTCTCATCTGAAGGTGGG - Intergenic
1190337701 X:49272255-49272277 ATGAAGTCTCAGATTATGGTGGG - Intronic
1193945165 X:87725062-87725084 CTGAAGTTTGGGATTAAGCTTGG + Intergenic
1194371320 X:93076471-93076493 CTGAAGTATAATATGAAGTTAGG - Intergenic
1194955304 X:100172394-100172416 ATGAAATCTCAAAGGAAGCTAGG + Intergenic
1197109387 X:122755369-122755391 CTGAAGTCTCACCTGAGACTAGG + Intergenic
1197869543 X:131051914-131051936 GTGATGTCTTAGATGGAGCTTGG - Intergenic
1198168977 X:134086180-134086202 CTGTAGTCTGAGAAGATGCTTGG - Intergenic
1200679117 Y:6188348-6188370 CTGAAGTATAATATGAAGTTAGG - Intergenic
1202096849 Y:21260249-21260271 CTAAATTCTCAGATGAAGATTGG - Intergenic
1202599207 Y:26575264-26575286 CTGAAGAATCAGCTGAACCTGGG + Intergenic