ID: 1130899202

View in Genome Browser
Species Human (GRCh38)
Location 15:88194305-88194327
Sequence GCTCAGAGCAGAGCACTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 270}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130899202_1130899208 17 Left 1130899202 15:88194305-88194327 CCCCCAAGTGCTCTGCTCTGAGC 0: 1
1: 0
2: 1
3: 23
4: 270
Right 1130899208 15:88194345-88194367 AGCACTCAAATGTGCATCTCTGG 0: 1
1: 0
2: 1
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130899202 Original CRISPR GCTCAGAGCAGAGCACTTGG GGG (reversed) Intronic
900197853 1:1386152-1386174 GCTGGGAGCAGGACACTTGGAGG - Intronic
900782778 1:4628836-4628858 GCTGAGAGCAGAGAACTGTGCGG + Intergenic
900987890 1:6083631-6083653 GCTCAGAGCTGAGCCCCCGGTGG + Intronic
901233053 1:7651909-7651931 GCACAGGGCATCGCACTTGGAGG + Intronic
901815044 1:11789053-11789075 ACTCAGAGCAGAGCAAATGAGGG - Exonic
901949882 1:12735262-12735284 ACTCACAGCAAAGCCCTTGGTGG + Intergenic
902753421 1:18533251-18533273 ACTCAGGGCAGAAGACTTGGTGG - Intergenic
903174227 1:21571005-21571027 GCTCAGAGCTGTGCACCTGGTGG + Intronic
904289041 1:29471789-29471811 TTACAGAGCAGAGCACTTAGAGG - Intergenic
904875446 1:33651338-33651360 GCTCAGAACAGAGCTCTTCTGGG + Intronic
905359988 1:37412579-37412601 GCTCAGAACAGAGCACAAGCCGG - Intergenic
905495710 1:38384185-38384207 GAACAGAGCAGAGTACTTTGTGG - Intergenic
906544413 1:46611424-46611446 GCTCAAGGCAGAGATCTTGGTGG + Intronic
906614428 1:47225047-47225069 GCTCACAGCAAAGCACATGCAGG + Intronic
911735434 1:101331587-101331609 GCTCAGAGGAGAGGTCTGGGTGG + Intergenic
916214262 1:162382421-162382443 GCACAGAGCCGAGGACATGGTGG - Intronic
917662608 1:177192125-177192147 GCTCATAGCAGAGCAATTATTGG - Intronic
918038452 1:180897485-180897507 GAGCAGAGCAGAGCCCTGGGGGG - Intergenic
918076715 1:181176159-181176181 GCTCACAGGGGAGCTCTTGGAGG + Intergenic
918237717 1:182596867-182596889 GCACAGATCTGAGCACTTTGTGG - Intergenic
918828017 1:189352505-189352527 GCTCTGAGCAGAGCAGTGTGAGG - Intergenic
923557087 1:235009806-235009828 GCTGAGAGAAGAGCAGATGGAGG + Intergenic
1063375290 10:5551027-5551049 GCTGAGGGCAGAGGCCTTGGAGG - Intergenic
1065674101 10:28155808-28155830 GCTCAGTGCAGATGACTTTGGGG + Intronic
1065996487 10:31064133-31064155 GCTCAGCTCATAGCACGTGGGGG + Intergenic
1067093354 10:43283066-43283088 GCACCGAGGACAGCACTTGGGGG + Intergenic
1067143782 10:43678818-43678840 GCTGCGAGCAGAGAACATGGTGG - Intergenic
1069932445 10:71891843-71891865 GCCCAGAGCTGGGCACTTGCCGG - Intergenic
1070784315 10:79154292-79154314 GCTCTCAGCAGAGTCCTTGGAGG - Intronic
1070985489 10:80686424-80686446 GCCCAGAGCAGAGCAGTGTGGGG + Intergenic
1071357181 10:84810033-84810055 GTTCAGAGTGGAGCCCTTGGAGG + Intergenic
1072223213 10:93345193-93345215 GCTCAGTGCCCAGCACATGGTGG - Intronic
1074870961 10:117575781-117575803 GGTCAGGGCAGAGGACTTAGGGG + Intergenic
1075046229 10:119148584-119148606 CCTCAGAGCTGGGCATTTGGAGG - Intronic
1077237877 11:1490908-1490930 ACTAAGATCAGAGCACTGGGTGG + Intronic
1077549266 11:3192821-3192843 GCTGAGACCAGAGGACTTGGGGG + Intergenic
1077674932 11:4187330-4187352 GCTCAGTGTAGAGCTCGTGGGGG + Intergenic
1080029566 11:27646612-27646634 GCTCAGAGCAGGTTGCTTGGAGG + Intergenic
1081927166 11:46840619-46840641 GCTGAGAGCTGAACACATGGTGG + Intronic
1083631436 11:64097444-64097466 GCCCAGAGCAGGGCACTTCAGGG - Intronic
1083647019 11:64177843-64177865 GTTCAGAGAAGAACACATGGAGG - Intergenic
1083988490 11:66232396-66232418 GCTCAGTTCAGAGCAGGTGGGGG - Intronic
1084494716 11:69497262-69497284 GCTCAGAGCAGGGCCCTGGAAGG - Intergenic
1087162605 11:94964082-94964104 GCTCAGAGCAGAACTCTGGTTGG + Intronic
1087706923 11:101503937-101503959 GCACAGTGCTGAGCACATGGGGG + Intronic
1089201475 11:116727148-116727170 GCCCAGAGTGCAGCACTTGGTGG - Intergenic
1089625851 11:119750361-119750383 GGTCAGAGAGGAGCTCTTGGGGG - Intergenic
1089685948 11:120147014-120147036 ACCCAGAGCAGAGCACTCGGGGG + Intronic
1090136991 11:124209475-124209497 GCTAAGAGCTGGGCACTTGACGG - Intergenic
1090748444 11:129725807-129725829 GCTCAGAGGGGAGCAATGGGTGG - Intergenic
1091088397 11:132746015-132746037 GCTCAGAGCAGAGCCCTGCTGGG - Intronic
1091627928 12:2137032-2137054 GCTCAGAGCATAACATGTGGGGG + Intronic
1091935452 12:4431211-4431233 GCTCATTGCTCAGCACTTGGGGG + Intronic
1091949301 12:4579890-4579912 GGTCAGAGGAGATCACTGGGTGG + Intronic
1093764932 12:22952335-22952357 GCTGAGAGCTGAACACTTGTTGG - Intergenic
1094427354 12:30328706-30328728 GCTGAGAGCTGAACACTTGATGG + Intergenic
1096028596 12:48390379-48390401 ACTCAGAGCAGTTCACTTGAAGG + Intergenic
1099683377 12:85856707-85856729 GCTGAGAGCTGGGCACTTGTTGG - Intergenic
1101030340 12:100651962-100651984 GCTCAGAGCAGAGCAGATCAGGG + Intergenic
1101721361 12:107353225-107353247 GCTCAGAGCCAGGCACTTAGTGG - Intronic
1102456523 12:113074285-113074307 GCTCAGAGGACAGCAATAGGAGG + Intronic
1102672659 12:114633235-114633257 TCTGAGAGATGAGCACTTGGTGG - Intergenic
1102743098 12:115225258-115225280 GCTCAGAGCTAGGCACTGGGAGG - Intergenic
1103813398 12:123633824-123633846 CCTCAGCGCAGAGCAAGTGGTGG - Exonic
1105717473 13:23081774-23081796 CCACAGAGCAGAGCACGTGGGGG - Intergenic
1106537432 13:30659896-30659918 GCTGAGAGCTGAACACTTGAGGG - Intronic
1111337198 13:86839800-86839822 GCTGAGAGCTGAACACTTGTTGG - Intergenic
1111353411 13:87063659-87063681 TCTCTGAGCATAGCACCTGGAGG + Intergenic
1112025043 13:95404021-95404043 GCTAAGGGCAGACCATTTGGTGG - Intergenic
1112227447 13:97553622-97553644 CCACAGAGTAGAGCACTGGGCGG - Intergenic
1112914186 13:104525661-104525683 TCTCAGAGTAGACCAGTTGGGGG - Intergenic
1113481721 13:110626335-110626357 GCTCAGACCAAAACCCTTGGTGG - Intronic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1115364259 14:32539355-32539377 GCTCACAACATAGCACTTTGTGG + Intronic
1118200067 14:63663457-63663479 GCTGAGAGCCGAACACTTGATGG - Intergenic
1118883495 14:69848552-69848574 GCTCAGAGAAGGGGACTGGGTGG - Intergenic
1119599209 14:75963523-75963545 GAAGAGAGCAGAGCCCTTGGAGG + Intronic
1121553312 14:94818823-94818845 GCTGAGAGTTGAACACTTGGCGG - Intergenic
1121562710 14:94886817-94886839 GCTCAGAGCAGAGTCCCTGGAGG - Intergenic
1122278097 14:100605497-100605519 GCTCAGAGCAGAGGGGCTGGGGG + Intergenic
1124035703 15:26052086-26052108 GCACAGGCCAGAGCACATGGTGG + Intergenic
1126228872 15:46302277-46302299 GCTCAGTGCAGAGCATTCTGTGG - Intergenic
1126679815 15:51191971-51191993 AGTCAGAGCGGAGCACTTTGGGG - Intergenic
1126679829 15:51192040-51192062 AGTCAGAGCGGAGCACTTTGGGG - Intergenic
1127397737 15:58556003-58556025 GCTCAGAGCTGAGCAGTGGAGGG + Intronic
1128350757 15:66886905-66886927 AGTCAGAGCAGAGCACCAGGAGG - Intergenic
1129908197 15:79204679-79204701 GCTCAGAGCTCAGCACATGCTGG + Intergenic
1130899202 15:88194305-88194327 GCTCAGAGCAGAGCACTTGGGGG - Intronic
1130948676 15:88568435-88568457 GCCCAGGGCATAGCACCTGGAGG - Intergenic
1132156570 15:99499935-99499957 GCTCAGAGCTGAGCAAGTAGAGG + Intergenic
1132394597 15:101463503-101463525 GCACATAGTAGAGCACTTTGAGG - Intronic
1132591354 16:727691-727713 CCGGAGAGCAGAGCACGTGGGGG - Intronic
1132815798 16:1826162-1826184 GCGCAGCGCAGGGCACTGGGCGG - Intronic
1133455982 16:5942992-5943014 GGTCAGTGCAGACCCCTTGGGGG - Intergenic
1133491948 16:6278731-6278753 GCTTAGAGCAGAGTAGGTGGGGG + Intronic
1135969072 16:27059151-27059173 GCTCAGATAAGAGCACTCTGTGG + Intergenic
1136450642 16:30352664-30352686 GCACAGAGCAGCGCAGTTGGGGG + Exonic
1137256459 16:46778845-46778867 GCTGAGAACTGAACACTTGGTGG + Intronic
1137588690 16:49680232-49680254 GCTGAGAGCTGGGCACTTGTTGG + Intronic
1138033497 16:53579884-53579906 GCTGAGAGCTGAACACTTGTTGG - Intergenic
1138735410 16:59245052-59245074 GCACAGATCAGAGCACGTAGAGG + Intergenic
1139305583 16:65983170-65983192 GCTCACAGCAGAGGACTTGGTGG - Intergenic
1141617066 16:85215951-85215973 GCTGTGAGCAGAGCCCTTGGAGG + Intergenic
1142059607 16:88020904-88020926 ACTCAGAGCAGAGTCCATGGCGG + Intronic
1142317237 16:89355520-89355542 GTTCAGAGCAGAGCATGTGCCGG - Intronic
1144060894 17:11582837-11582859 GCTGGGAGCTGAGCACTTGTTGG - Intergenic
1144320286 17:14110689-14110711 GTTCAGAGCAGAGAACTAGGAGG - Intronic
1144491448 17:15714752-15714774 GTTCAGAGCCTAGCACATGGAGG + Intronic
1144850987 17:18243928-18243950 GCTCCGAGCAGGGCAGGTGGAGG - Exonic
1144909760 17:18671654-18671676 GCTCAGGCCCGAGCCCTTGGTGG + Intronic
1144998854 17:19289470-19289492 GCTGGGAGCAGAGCAGCTGGAGG + Intronic
1145797142 17:27662265-27662287 GCACAGGGCACAGCACCTGGGGG + Intergenic
1145811538 17:27767206-27767228 GCACAGGGCACAGCACCTGGGGG + Intronic
1145924922 17:28639663-28639685 GATCAGAGGAGAGCACTGGAAGG + Intronic
1146351941 17:32102368-32102390 GCTCAGAGGACACCACGTGGTGG + Intergenic
1146451739 17:32980121-32980143 GCTGAGAGCAGCGGACCTGGGGG - Intronic
1146459493 17:33034082-33034104 GCTGAGAGCTGAGCACTCGATGG + Intronic
1147238418 17:39074635-39074657 GCCCAGGGCACAGCACTTGGGGG - Intronic
1147238530 17:39075291-39075313 ACTGAGAGCAGAGCACGTGGTGG - Intronic
1148743766 17:49907413-49907435 GCTCAGACCAGTGAACTGGGGGG + Intergenic
1152234445 17:79131300-79131322 GCACAGAGCACAGCACACGGAGG - Intronic
1152539184 17:80966428-80966450 GGTCAGAGCAGAGCTCTGGGGGG + Intergenic
1152780804 17:82226710-82226732 TCTAAAAGCTGAGCACTTGGAGG + Intergenic
1153997477 18:10454676-10454698 GCTCAGAGCGGCGCACGCGGCGG + Exonic
1154259712 18:12819950-12819972 GCTCAAAGCAGACCACATGAAGG - Intronic
1156160405 18:34351483-34351505 GCTGAGAGCTGAACACTTGATGG + Intergenic
1157199015 18:45643208-45643230 GCTCTGGGAAGAGCACTTTGGGG - Intronic
1157422148 18:47556200-47556222 GCACAGGGCAGAGTAATTGGGGG - Intergenic
1158688145 18:59633359-59633381 TCTCAGAGCAGTGATCTTGGAGG - Intronic
1158821073 18:61159409-61159431 GCTCAGAGCAGAAATATTGGAGG - Intergenic
1159398045 18:67890416-67890438 GCTCACATCAGTACACTTGGAGG - Intergenic
1160153683 18:76415431-76415453 GCTCAGAGGCGTGCACTTAGTGG - Intronic
1160581121 18:79885105-79885127 GCTCAGAGCACAGAACATCGTGG + Intronic
1161580282 19:5077146-5077168 GCTCACAGCAGGGCACTATGGGG + Intronic
1163740107 19:19006622-19006644 GCTCAGTGCAGGGCAGCTGGGGG - Intronic
1163908027 19:20164613-20164635 GATCAGAGCAGAACCCTAGGGGG + Intergenic
1164786216 19:30933231-30933253 CCTCAGAGCAGAACATTTGCAGG + Intergenic
1165311107 19:35030083-35030105 GCTCAGGGGAGATAACTTGGAGG + Intergenic
1167276269 19:48541903-48541925 GGCCAGAGCAGAGAACATGGGGG - Intergenic
1167346284 19:48947400-48947422 ACTGAGAGCTGAGCACTTGGTGG + Intergenic
925515360 2:4675038-4675060 GCTGAGAGCTGAGCACCTGTTGG + Intergenic
926592181 2:14751545-14751567 ACTCAGGACAGAGCTCTTGGAGG - Intergenic
927095466 2:19744794-19744816 GCTCAGTTCAGGGAACTTGGGGG + Intergenic
929801199 2:45104597-45104619 GCTGAGACCAGAGAACTGGGTGG + Intergenic
932272207 2:70420142-70420164 GCTCAGATCATATCACTGGGAGG - Intergenic
934608928 2:95720303-95720325 GGCCAGAGCAGAGCCCGTGGAGG + Intergenic
934777735 2:96949807-96949829 GCCCAGAGCAGAGCTCTGTGGGG + Intronic
936350233 2:111706919-111706941 GCACAGGGCACAGCACTTGCAGG - Intergenic
936542231 2:113361769-113361791 GGCCAGAGCAGAGCCCGTGGAGG + Intergenic
937867424 2:126763504-126763526 GCTCAGACCAGAGCAAGTCGTGG - Intergenic
938812538 2:134866990-134867012 ACTCAGAGCCCAGCACTGGGTGG - Intronic
938945924 2:136211981-136212003 GCACAGGGCTGAGCACATGGTGG + Intergenic
942694732 2:178628766-178628788 GCACAGCCCAGAGCACTTGAAGG + Intronic
942708344 2:178802383-178802405 GGACAGAGCAGAGGACTTTGTGG - Intronic
945846210 2:214948287-214948309 GCTCTGGGCTGAGCACTGGGTGG - Intronic
948549632 2:238761633-238761655 GGTCAGAACAGTGCTCTTGGGGG + Intergenic
948783395 2:240338602-240338624 GCTTAGAGCAGAGCAGTCAGGGG + Intergenic
949005993 2:241648294-241648316 TGTAAGAGCAGAGCTCTTGGGGG + Intronic
949058623 2:241943614-241943636 GCTCAGAGGAGAGCACTCCCCGG + Intergenic
1168999297 20:2155528-2155550 CCTGAGAGCAGAGCACTGGCTGG - Intronic
1169543947 20:6631640-6631662 GTTCAGAGCACAGCATTTGGTGG + Intergenic
1171095945 20:22332357-22332379 CCCCAGTGCAGAGCAGTTGGGGG + Intergenic
1171398931 20:24859199-24859221 GCCCAAAGGAGAGCACTGGGAGG + Intergenic
1174210023 20:48870598-48870620 TCTGAGAGCAGGGCACTTGGTGG - Intergenic
1175172901 20:57092600-57092622 GCTCAGGGCAGGGCTCTTGCAGG - Intergenic
1175968913 20:62674121-62674143 GCTCTGAGCAGAGGGCTTGAGGG - Intronic
1176205758 20:63887336-63887358 GCCCAGCGCATAGCACTGGGAGG - Intronic
1179887111 21:44318925-44318947 GATCAGAGCAGAGCCCTGGGAGG + Intronic
1179964224 21:44791782-44791804 GCACAGTGCAAAGCTCTTGGTGG - Intronic
1180050630 21:45329512-45329534 GCTGTGAGCAGCGCACCTGGAGG - Intergenic
1181633996 22:24166011-24166033 TCTCACAGCTGAGCACCTGGAGG + Intronic
1182283656 22:29231901-29231923 GCTCTGAGCTGGGCACTGGGTGG + Intronic
1182989920 22:34757635-34757657 TCTCAGAGCAGTGGATTTGGGGG - Intergenic
1183690128 22:39383565-39383587 GAGCAGAGCAGAGCAGGTGGTGG + Exonic
1183745500 22:39689337-39689359 GCTCTGAGCTGAGGATTTGGGGG - Exonic
1184653720 22:45930938-45930960 GCTCAGAGCCATGCACGTGGAGG + Intronic
1185148173 22:49150386-49150408 GCCCTGATCAGAGCTCTTGGAGG - Intergenic
949272225 3:2231329-2231351 GCTCAGAGAAGAGGACTGGGAGG + Intronic
949478717 3:4472894-4472916 GCCCACAGCAGAGCTCTTGTAGG - Intergenic
949688114 3:6601080-6601102 GCTCAGAGCAGAGGGCTAGATGG + Intergenic
949863784 3:8530385-8530407 GAGCAGAGCAGAGCACTCGCCGG - Intronic
950883615 3:16344048-16344070 TCACAGCCCAGAGCACTTGGAGG + Intronic
950900287 3:16491397-16491419 GCTCTGAGCAGAGAACTGGCAGG + Intronic
952016186 3:28959526-28959548 GCTGAGAGCTGAACACTTGATGG + Intergenic
953606162 3:44414707-44414729 ACTCAGAGCAGAGCACGCGAGGG - Intergenic
953701613 3:45200341-45200363 GCTAAGATGAGAACACTTGGAGG + Intergenic
954386698 3:50247842-50247864 GCTGGGGACAGAGCACTTGGTGG + Intronic
954423337 3:50430335-50430357 GCTCAGAGGAGAGGCCATGGGGG - Intronic
954638537 3:52084746-52084768 GCTCTTAGCAGAGCCCTGGGTGG + Intronic
955536960 3:59933951-59933973 GTTCAGAGTAGAGCTCTGGGAGG + Intronic
955787728 3:62557575-62557597 CCTCAGAGGAGAGAACATGGGGG - Intronic
956055245 3:65291523-65291545 GCTCAGAGCAGAGGAGTTAATGG + Intergenic
956462261 3:69484575-69484597 GCTGAGAGCTGAACACTTGATGG - Intronic
956733018 3:72214180-72214202 GCCGAGAGCAGAGCAGCTGGTGG - Intergenic
957586894 3:82144282-82144304 ACTCAGAACAGAACAATTGGAGG - Intergenic
957889330 3:86335308-86335330 GTGCTGAGCAGAGAACTTGGTGG + Intergenic
958195370 3:90236096-90236118 GCTGAGAGCTGAACACTTGATGG + Intergenic
960690651 3:120342590-120342612 GCTGAGAGCTGAACACTTGAAGG + Intronic
962239266 3:133737462-133737484 GATCAGAGCAGAGCTGTGGGAGG + Intergenic
962723614 3:138199837-138199859 GATCTGAGCAGTGTACTTGGTGG + Intronic
964402530 3:156314183-156314205 GCACAGTTCAGAGCACTTGAGGG + Intronic
967130659 3:186467664-186467686 ACTCAGAGCAGAACCTTTGGAGG - Intergenic
967180332 3:186897727-186897749 GCTCAGATGAGAGCACTTCTGGG - Intergenic
967295345 3:187958852-187958874 GCTCTGAGCAGCACACTCGGAGG - Intergenic
968482705 4:843481-843503 GCACCGAGCAGAGCAGGTGGTGG + Intergenic
969470491 4:7384831-7384853 ACTCAGAGGAGAGCCCTTTGCGG + Intronic
969620803 4:8277846-8277868 GCTCACAGCTGACCACTGGGTGG + Intronic
969628976 4:8324362-8324384 GCTGCAGGCAGAGCACTTGGGGG - Intergenic
970977334 4:22057019-22057041 GCACAGATCAGAGCCCTAGGAGG + Intergenic
972226683 4:37021433-37021455 GCTCATATCCTAGCACTTGGGGG - Intergenic
974619901 4:64341104-64341126 GCTAAGAGCTGAACACTTGTTGG + Intronic
975361111 4:73473597-73473619 GCCCAGTTCAGAACACTTGGTGG + Intergenic
977487288 4:97665412-97665434 GCTGAGAGCTGAACACTTGTTGG - Intronic
977571403 4:98633041-98633063 GCTCAGACCAGGGCACTGGTTGG + Intronic
978550445 4:109919713-109919735 GATCAGAGGAGAGCTCTTGATGG + Intronic
978839557 4:113194125-113194147 ACTGAGAGCTGAGCACTTAGTGG + Intronic
981700992 4:147607411-147607433 TCCCAGAACAAAGCACTTGGTGG - Intergenic
983715489 4:170776659-170776681 GCTGAGAGCTGAGCACTCGTTGG + Intergenic
984325244 4:178242341-178242363 TCTGAGAGCTGAGCACTTGTTGG + Intergenic
984840873 4:184066107-184066129 TCTCAGAGCAGATGACTGGGAGG - Intergenic
985542245 5:492436-492458 GGTCAGGGCAGAGCCCTCGGGGG + Intronic
987869677 5:23599360-23599382 GCTGAGAGAAGAGAACTTAGAGG - Intergenic
988611118 5:32726098-32726120 GCTCAGAGCGGAGCAGTTGTAGG + Intronic
990692566 5:58379645-58379667 CTTCAGAGCAGAGTCCTTGGAGG - Intergenic
992088886 5:73300784-73300806 GCTCAGAGCAAAGCGATTGCAGG - Intergenic
992919721 5:81502107-81502129 GCTGAGAGGAGAGAAATTGGAGG - Intronic
993033496 5:82731104-82731126 GTTCAGAACAGAGGACTTAGGGG - Intergenic
996089992 5:119341175-119341197 TTTCAGAGCAGAGCACTGGAGGG - Intronic
998418455 5:141962152-141962174 GCTCCTAGCAGGGCACTTTGTGG + Intronic
999260119 5:150233057-150233079 GCTCATAGATGAGCTCTTGGGGG + Intronic
1000639359 5:163683212-163683234 ACTGAGAGGAGAGCATTTGGGGG + Intergenic
1000750091 5:165084599-165084621 GCTGAAACCAGAGTACTTGGGGG - Intergenic
1001187283 5:169586633-169586655 GCTCAGGCCAGAAGACTTGGAGG + Intronic
1002269828 5:178063844-178063866 GCTGAGAGCAGATTACTAGGGGG + Intergenic
1002461126 5:179374355-179374377 CGTCAGGGCAGAGGACTTGGAGG + Intergenic
1002956493 6:1870241-1870263 GTACAGAGAAGTGCACTTGGTGG + Intronic
1003026411 6:2559103-2559125 GCTCAGATCTCAGCACTGGGAGG + Intergenic
1006309545 6:33248286-33248308 CCACAGAGCAGAGGATTTGGGGG + Intergenic
1007130089 6:39464211-39464233 GCTCAGAGCTGAGCAGTGGAGGG + Intronic
1008601949 6:53104948-53104970 GCTCAGTGCAGAGTTTTTGGGGG + Intergenic
1008809949 6:55484324-55484346 GATCAGAGCAGAGTAGTTTGAGG - Intronic
1010404014 6:75482063-75482085 GCTCAGAGAAGAGGACAAGGGGG - Intronic
1013281273 6:108639206-108639228 GGTGAGAGAAGAGCACTGGGTGG + Intronic
1013511721 6:110850746-110850768 GTTCAAAGCAGAGCAGCTGGAGG + Intronic
1017155284 6:151317284-151317306 GAACAGAGAAGAGCAGTTGGAGG - Intronic
1018652339 6:166002800-166002822 GCTCAGGGCAGAGCTCCTGGTGG + Intergenic
1019215986 6:170444175-170444197 GCTCAGAGCAGAAGGCTTGTAGG + Intergenic
1019306715 7:338956-338978 GCACAGAGCGGGGCTCTTGGGGG - Intergenic
1021138335 7:16992893-16992915 GCTCAAATCAGAGCACTTATAGG + Intergenic
1023296252 7:38717798-38717820 GCTCAGAGCAGAGCTCCAGGGGG + Intergenic
1023964523 7:44955999-44956021 GCTGAGAGCTCAGCACATGGGGG + Intergenic
1024157541 7:46640138-46640160 GCTCAGAGATGAGCACTATGGGG + Intergenic
1024630407 7:51242720-51242742 TCTCAGAACAGAGCAGATGGTGG - Intronic
1024833581 7:53490309-53490331 TCCCAAAGCCGAGCACTTGGTGG - Intergenic
1025014467 7:55427840-55427862 GCTCAGAGGAGAGCACAGGGAGG + Intronic
1027336561 7:77157068-77157090 ACTCAGAGCTGACCCCTTGGAGG - Intronic
1028687015 7:93601622-93601644 GCTCAGAGCAGTGCTCTCTGTGG + Intronic
1029779231 7:102714041-102714063 ACTCAGAGCTGACCCCTTGGAGG + Intergenic
1030502454 7:110376783-110376805 GCACAGGGCAGAGCAAGTGGTGG + Intergenic
1031242030 7:119258014-119258036 GCTGAGAGCTGAACACTTGAAGG - Intergenic
1032468708 7:132162924-132162946 CCTCAGCTCAGAGCAGTTGGAGG + Intronic
1032658298 7:133955373-133955395 GCTGAGAGCTGAACACTTGACGG - Intronic
1034557395 7:151858822-151858844 GCACAGTGTGGAGCACTTGGAGG + Intronic
1035592018 8:823588-823610 GGTCTGTGCAGAGCTCTTGGGGG - Intergenic
1035614021 8:989167-989189 CCTTTGATCAGAGCACTTGGGGG + Intergenic
1038779609 8:30558614-30558636 GATGAGAGCAGAGGAGTTGGTGG + Intronic
1040786793 8:51176261-51176283 GTTGAGTGCAGAGCACATGGTGG - Intergenic
1040981031 8:53246338-53246360 GCTCAGGGCAGAGGACTGCGTGG + Intronic
1048255759 8:132904071-132904093 GCTCAGAGCACAACACTTCCTGG + Intronic
1048979062 8:139693454-139693476 GCTGAGAGCTGAGCAGTTTGGGG - Intronic
1049394719 8:142394622-142394644 GCACAGAGCAGAGCTGTGGGAGG - Intronic
1049986869 9:959960-959982 GCACAGTGCAGAGCACATAGTGG - Intronic
1055029743 9:71761741-71761763 GCTCACAGCCCAGCATTTGGGGG + Intronic
1055749522 9:79489377-79489399 GCTTAGAGCTGAGCTCTTGGTGG + Intergenic
1055973586 9:81934561-81934583 GGTCAGAGCAGAGCCCTTCCAGG + Intergenic
1056911866 9:90708360-90708382 GCTCAGAGAACAGCACTGCGTGG - Intergenic
1057208977 9:93189365-93189387 CCTCAGCTCAGAGCACTTGCTGG + Intronic
1057919878 9:99088239-99088261 GCTTAGGCCAGAGCACTAGGAGG + Intergenic
1058091978 9:100814751-100814773 GCTGAGAGCTGAGCACTTGATGG + Intergenic
1058136117 9:101309415-101309437 GCTCAGAGCAGCGTGTTTGGAGG - Exonic
1058510823 9:105714088-105714110 GTTGAGAGCCGAGCACTTGTTGG + Intronic
1058780075 9:108324727-108324749 ACACAGAGCATAGCCCTTGGTGG - Intergenic
1060210815 9:121709109-121709131 GCTCAGAGGGAAGCAGTTGGTGG - Intronic
1060523917 9:124309907-124309929 CCTCAGTGCAGAGGACGTGGAGG + Intronic
1060822089 9:126667221-126667243 GTACAGAGCAGAGCAGTTAGAGG - Intronic
1061087730 9:128409163-128409185 GCCCAGAGCAGAGGCCTGGGTGG + Intergenic
1061304728 9:129725669-129725691 GCCCAGAGCAGAGCACTCACGGG + Intergenic
1187368749 X:18686353-18686375 GCTCAGAGCACCACACTAGGGGG + Intronic
1187369299 X:18691094-18691116 GGTAAGAGAAGAGCACTTAGTGG + Exonic
1190128283 X:47724615-47724637 GCTCAGGACACAGCACCTGGAGG - Intergenic
1190369539 X:49727532-49727554 GCTGAGAGCTGAGCACTTGTTGG + Intergenic
1190895618 X:54614885-54614907 GCTCTGGACAGAGCAGTTGGTGG - Intergenic
1194780388 X:98018126-98018148 GCTCAGATTAGAAAACTTGGTGG - Intergenic
1195598685 X:106722062-106722084 GCTCAGAGCAAAGGTCCTGGTGG + Intronic
1200081089 X:153576714-153576736 GCTGAGAGCAGAGCAGGAGGCGG + Intronic