ID: 1130905476

View in Genome Browser
Species Human (GRCh38)
Location 15:88237467-88237489
Sequence GACACAAGTGTGGTGCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130905462_1130905476 28 Left 1130905462 15:88237416-88237438 CCCAGCCCGTTGTCATTGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 81
Right 1130905476 15:88237467-88237489 GACACAAGTGTGGTGCTCACTGG 0: 1
1: 0
2: 0
3: 13
4: 131
1130905469_1130905476 22 Left 1130905469 15:88237422-88237444 CCGTTGTCATTGTGTGGGGGTGG 0: 1
1: 0
2: 1
3: 20
4: 367
Right 1130905476 15:88237467-88237489 GACACAAGTGTGGTGCTCACTGG 0: 1
1: 0
2: 0
3: 13
4: 131
1130905464_1130905476 27 Left 1130905464 15:88237417-88237439 CCAGCCCGTTGTCATTGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1130905476 15:88237467-88237489 GACACAAGTGTGGTGCTCACTGG 0: 1
1: 0
2: 0
3: 13
4: 131
1130905474_1130905476 -8 Left 1130905474 15:88237452-88237474 CCTAACATGGTTACTGACACAAG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1130905476 15:88237467-88237489 GACACAAGTGTGGTGCTCACTGG 0: 1
1: 0
2: 0
3: 13
4: 131
1130905468_1130905476 23 Left 1130905468 15:88237421-88237443 CCCGTTGTCATTGTGTGGGGGTG 0: 1
1: 0
2: 1
3: 24
4: 433
Right 1130905476 15:88237467-88237489 GACACAAGTGTGGTGCTCACTGG 0: 1
1: 0
2: 0
3: 13
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130905476 Original CRISPR GACACAAGTGTGGTGCTCAC TGG Intronic
902398392 1:16144561-16144583 GACACAAGTGTGGTGAGGAGGGG - Intronic
905184645 1:36187745-36187767 TATGCAAATGTGGTGCTCACAGG + Intergenic
909002672 1:70237705-70237727 GAGACAATTCTGGTGGTCACAGG + Intronic
915402922 1:155636943-155636965 GACACAGGTGTGAGGCTCTCTGG - Intergenic
918109365 1:181442195-181442217 GACTCAAGTGTGGGGGGCACAGG + Intronic
920302664 1:204998368-204998390 GAGACAAAGGTGGTGCCCACTGG - Intronic
920777280 1:208952167-208952189 AACCCAAGTGTGTTGCTCTCTGG - Intergenic
923229066 1:231966863-231966885 GATAAAAGTGTGATGCACACTGG - Intronic
923660595 1:235954052-235954074 GACACCGGTGTTGTCCTCACTGG - Intergenic
1063145037 10:3288954-3288976 GACACAGGTGTGCTGTTCAGGGG - Intergenic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1071141096 10:82510332-82510354 CCCACAAGTGTGATGCTGACAGG + Intronic
1071333456 10:84583427-84583449 GACCCCTGTGTTGTGCTCACTGG + Intergenic
1075369428 10:121922763-121922785 TACCCAAGTGTGGTTGTCACAGG - Intronic
1075411826 10:122233979-122234001 GACACAGGCCTGGTGCTCAGAGG - Intronic
1076337865 10:129720620-129720642 GACTCAACTGTGGTAGTCACTGG + Intronic
1077174941 11:1184806-1184828 GTCACAGGTGTGGAGGTCACGGG - Intronic
1077175508 11:1188124-1188146 GTCACAGGTGTGGAGGTCACGGG - Intronic
1077175899 11:1190317-1190339 GTCACAGGTGTGGAGGTCACGGG - Intronic
1077186416 11:1237323-1237345 GGCACAGGTGTGGGGCTGACGGG - Intronic
1077938259 11:6813272-6813294 GACACAAGTAGGGGGCTCTCAGG + Intergenic
1083366956 11:62147159-62147181 GTCAGGAGTGTGGTGCTCAGAGG + Intronic
1084684493 11:70685770-70685792 GACACAAGTCTCCTTCTCACTGG + Intronic
1088763935 11:112958723-112958745 GACAAAACTGTGGCCCTCACTGG - Intergenic
1089736033 11:120550750-120550772 GACAACAGTGAGGTGGTCACTGG + Intronic
1090387643 11:126365956-126365978 GACACACCTGTGGGGCTCATAGG + Intronic
1090390208 11:126383154-126383176 GACACACCTGTGGGGCTCATAGG + Intronic
1090467225 11:126945308-126945330 GCCACAAGTGTGGCTCTGACAGG + Intronic
1090765063 11:129869507-129869529 GACACAACCGTGGTGCTGACAGG + Exonic
1092196380 12:6552032-6552054 GACAGAAGTGATGAGCTCACAGG - Intronic
1098175559 12:67786776-67786798 GACATGAGTGCTGTGCTCACAGG - Intergenic
1101661533 12:106770154-106770176 AACACATATGTAGTGCTCACTGG - Intronic
1103940879 12:124500614-124500636 GACACAGGTGTGGTGGTTTCTGG - Intronic
1111792855 13:92880617-92880639 AAGACAAGTGTGGTGCTGGCTGG + Intergenic
1113015551 13:105824418-105824440 GAGGCAAGTGTGGTGCTAGCAGG - Intergenic
1113223012 13:108127109-108127131 GACACTGGTGTTGTTCTCACAGG - Intergenic
1123472862 15:20567945-20567967 GACACAGGTGAGGTGTTCAGAGG + Intergenic
1123645143 15:22432408-22432430 GACACAGGTGAGGTGTTCAGAGG - Intergenic
1123733167 15:23162936-23162958 GACACAGGTGAGGTGTTCAGAGG + Intergenic
1123751297 15:23360312-23360334 GACACAGGTGAGGTGTTCAGAGG + Exonic
1124299029 15:28527383-28527405 GACACAGGTGAGGTGTTCAGAGG - Exonic
1128157451 15:65400877-65400899 GACACCACTGTGGTGTTCTCTGG + Exonic
1128730191 15:70015654-70015676 TTCACAAGTTTGGTGCACACAGG + Intergenic
1128771306 15:70284462-70284484 GACCCAAGTGTGGATCTCGCTGG - Intergenic
1130905476 15:88237467-88237489 GACACAAGTGTGGTGCTCACTGG + Intronic
1134972174 16:18539860-18539882 AGCACAGGTGTGCTGCTCACAGG - Intronic
1136420693 16:30130808-30130830 GACAAAAGTGTGGTGATCAGAGG + Intergenic
1141977256 16:87525114-87525136 GACACAAGTGTGGCGTTAGCAGG + Intergenic
1142331609 16:89457871-89457893 CACACAAGTGTGGAGCTGAATGG + Intronic
1144555788 17:16281851-16281873 TACACAGGTGGGGTGCCCACTGG + Intronic
1144749008 17:17635343-17635365 GACACATGGTGGGTGCTCACAGG - Intergenic
1146958605 17:36952982-36953004 AACAGGAGTGTGGTGATCACAGG + Exonic
1148483854 17:47977937-47977959 GGCAAAAGTGGGGTGCTCAAGGG + Intronic
1149561543 17:57611265-57611287 AAAACAAATGTGGTGCTCATGGG - Intronic
1151490291 17:74428927-74428949 CACACAAGCCTGGTGCTTACAGG - Intronic
1157962940 18:52177192-52177214 GACACAAATGTGGTGGTCGAGGG + Intergenic
1159724002 18:71930718-71930740 GACACGGGTCTGGTGCTCATGGG + Intergenic
1159829625 18:73258939-73258961 GACACCGGTGTGGTCGTCACTGG + Intronic
1160754119 19:748733-748755 GAGACCAGTGTCATGCTCACGGG + Intergenic
1163702671 19:18793982-18794004 GAGGCAAGTGTGGTGTGCACAGG - Intergenic
1164630610 19:29759388-29759410 GGCACAAGTGTGGTGGTCGGGGG - Intergenic
1164630886 19:29760783-29760805 GGCACAAGTGTGGTGGTCGGGGG - Intergenic
1167340515 19:48913194-48913216 GGCACAAATGGGGTCCTCACAGG - Exonic
926205395 2:10831638-10831660 GACACAAGTAATCTGCTCACTGG + Intronic
928164558 2:28960792-28960814 GATACATGTTAGGTGCTCACTGG - Intronic
928714486 2:34044564-34044586 GACACAAATGTGCTACTCTCTGG - Intergenic
928777577 2:34784173-34784195 GACACAGGTGATCTGCTCACTGG + Intergenic
932570535 2:72936166-72936188 GACACAAGTGAGGTGGGCAGAGG - Intergenic
942721146 2:178953881-178953903 GACACAAGATTGGTGCCCAGAGG + Intronic
945935683 2:215900613-215900635 GACACAAGGGTGAAGCTAACGGG + Intergenic
948070976 2:235124844-235124866 GACCAAAGTGTGGTGATCCCAGG - Intergenic
1169135757 20:3196064-3196086 GCTACAAGTGTGGTAGTCACTGG - Intronic
1177436018 21:21052851-21052873 GACACAAATTTTGTGCTGACTGG - Intronic
1178660389 21:34502937-34502959 GCCAAAAGTGTGGTGCTGAGTGG - Intergenic
1179460898 21:41534353-41534375 GGCACCAGCATGGTGCTCACTGG + Intergenic
1179938908 21:44625734-44625756 GCCACCACTGTGGGGCTCACTGG + Intronic
1181053584 22:20248965-20248987 GCCCCCAGTGTGGGGCTCACTGG - Intronic
1183687456 22:39369407-39369429 GTCTCAAGTCTGGTGCTCAGAGG - Intronic
1183859300 22:40657865-40657887 CACAGAAGCGTGGTGCCCACAGG + Intergenic
958964398 3:100542631-100542653 GAACCAAGTGAGGTGCTCACTGG + Intronic
960694785 3:120385579-120385601 GTCACAAGGGTGGGGCTCCCAGG - Intergenic
960997926 3:123351800-123351822 CACCCAAGAGTGGTGCACACAGG + Intronic
968916193 4:3497971-3497993 GACACAGGTGTGGGGATCAAGGG + Intronic
969700627 4:8765811-8765833 GACAAAAGCGTGCTGCCCACGGG + Intergenic
972594380 4:40517020-40517042 GACCCAAGAGGGGTGCTCATGGG - Intronic
973614037 4:52661482-52661504 TCCACAAGTGTGGTATTCACAGG + Intergenic
974110136 4:57515486-57515508 GACACAGATGTGGTGCCCAAAGG + Intergenic
977459047 4:97300783-97300805 GACACAGCTGTAGTGGTCACAGG + Intronic
977577987 4:98694957-98694979 GACTCAGATGTGGTGCTCCCTGG + Intergenic
978039768 4:104045372-104045394 GAAACAATTGTCGTGCTCCCTGG - Intergenic
978102604 4:104861013-104861035 GACCCAAGTTTGATGCTCACTGG - Intergenic
978358951 4:107907874-107907896 GAGACAACTGTGGCACTCACTGG - Intronic
979302551 4:119103372-119103394 GATACAAGTGTGGTGTGCGCTGG - Intergenic
986614219 5:9600195-9600217 GTCACAAGTGGGGTGCTACCTGG - Intergenic
987698364 5:21361662-21361684 GTCATAAGTGTGGTGTTCTCAGG - Intergenic
990637901 5:57750073-57750095 GAGACAAGTTTGTTGCTTACTGG - Intergenic
995021772 5:107374619-107374641 GATACAAATGTACTGCTCACAGG + Intergenic
997196384 5:131982885-131982907 GACACAAGCTGGGAGCTCACGGG + Intronic
1000776640 5:165427562-165427584 GTCACAATAGTGGTGCACACCGG - Intergenic
1000965769 5:167654321-167654343 GAGACAAGTGAGGTGCACAGGGG + Intronic
1002571829 5:180143965-180143987 GACACGCGCGTGGTCCTCACAGG - Intronic
1003573418 6:7270903-7270925 GGCACCAGTGTGGTGTGCACAGG + Intronic
1003940235 6:11017307-11017329 GACTCAAGAGTGGTGCTATCAGG + Intronic
1006505002 6:34483468-34483490 GACCCAACTCTGGTGCCCACCGG - Intronic
1007768697 6:44176793-44176815 GATGCAAGTGTGCTGCTGACGGG + Intronic
1011412809 6:87083509-87083531 GAAACAATTGTGGTGATCATTGG - Intergenic
1011994549 6:93568604-93568626 GACACAAGTCTGGTATCCACTGG - Intergenic
1013174167 6:107663138-107663160 GCCCCAAGTGTGCTGCTGACTGG - Intergenic
1015547206 6:134373672-134373694 GAAACAAGTATGGTGCTCCCAGG + Intergenic
1016600363 6:145851899-145851921 GACACAGGGGTGGGGATCACTGG + Intergenic
1017519624 6:155190410-155190432 CACTAAAGTGTGGTCCTCACCGG + Intronic
1018643064 6:165922699-165922721 GACTCACGTGTGGAGCTCATGGG - Intronic
1018650003 6:165985691-165985713 GACACAGGTGTCCTGCACACAGG + Intronic
1018921852 6:168181021-168181043 GAGAAAAGTGTGGGGCTCGCAGG - Intergenic
1019105112 6:169661088-169661110 GGCACAGATGTGGTTCTCACTGG - Intronic
1019387532 7:766181-766203 CACACATGTGTGGTGCTCTTGGG + Intronic
1019770285 7:2879491-2879513 TACACATATGTGCTGCTCACAGG - Intergenic
1027436717 7:78172364-78172386 CACAGGAGTGTGGTGCACACTGG - Intronic
1027832200 7:83192765-83192787 AACACAAGTGTGGTGGTAGCCGG - Intergenic
1029517315 7:101033496-101033518 GCCACCAGTGTGGTGTTGACAGG - Exonic
1029517373 7:101034027-101034049 GCCACCAGTGTGGTGCTGACAGG - Exonic
1029517439 7:101034558-101034580 GCCACCATTGTGGTGCTGACAGG - Exonic
1029517523 7:101035266-101035288 GTCACCAGCGTGGTGCTGACAGG - Exonic
1029517544 7:101035443-101035465 GCCACCAGTGTGGTGTTGACAGG - Exonic
1029517817 7:101037915-101037937 GCCACCACTGTGGTGCTGACAGG - Exonic
1029517878 7:101038446-101038468 GCCACCATTGTGGTGCTGACAGG - Exonic
1029518126 7:101040747-101040769 GTCACCGGTGTGGTGCTGACAGG - Exonic
1029518270 7:101041983-101042005 GCCACCGGTGTGGTGCTGACAGG - Exonic
1029518324 7:101042514-101042536 GTCACACGTGTGGTGCTGACAGG - Exonic
1035191943 7:157177617-157177639 GACACCAGTGTGGTGCTGAGGGG + Intronic
1035479519 7:159170952-159170974 CACACCAGTGTCCTGCTCACAGG - Intergenic
1038049269 8:23793724-23793746 CCCACAACTGTGGTGCTCAGAGG - Intergenic
1039228167 8:35412954-35412976 AACACACGTGTGGGTCTCACTGG + Intronic
1048849010 8:138626671-138626693 TACACAAGTGGGGAGCTGACCGG + Intronic
1048894329 8:138975897-138975919 GCCACAAGTGTGGTGCTCTGGGG + Intergenic
1049759086 8:144323807-144323829 GCCCCAAGTGTGGGACTCACTGG - Intronic
1051093521 9:13438013-13438035 GACACAAGTGTGTTTGTGACTGG - Intergenic
1061637842 9:131926012-131926034 GACACCAGTCTGGGCCTCACAGG - Intronic
1191105360 X:56768949-56768971 GGGACAAGTGTGGTGCGCACAGG - Intergenic
1191106353 X:56774351-56774373 GGGACAAGTGTGGTGCGCACAGG - Intergenic
1191107346 X:56779753-56779775 GGGACAAGTGTGGTGCGCACAGG - Intergenic
1196541278 X:116911468-116911490 GACACAGGTGTGGTGCACCTGGG - Intergenic
1199121413 X:144058754-144058776 TACACATGTGTGTTTCTCACTGG + Intergenic
1199808782 X:151328507-151328529 GTCAAAAGTGTGGTGCTCATGGG - Intergenic
1201719027 Y:17077194-17077216 AACAGAAGTGTTGTCCTCACAGG - Intergenic