ID: 1130905949

View in Genome Browser
Species Human (GRCh38)
Location 15:88241033-88241055
Sequence CCCAAGAGCCCCCACCTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130905949_1130905952 13 Left 1130905949 15:88241033-88241055 CCTACTAGGTGGGGGCTCTTGGG 0: 1
1: 0
2: 0
3: 17
4: 128
Right 1130905952 15:88241069-88241091 AAGCCTCAATGCCAGCCTTCAGG 0: 1
1: 0
2: 0
3: 20
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130905949 Original CRISPR CCCAAGAGCCCCCACCTAGT AGG (reversed) Intronic
900431985 1:2606827-2606849 CCCAAGAGGCCCAACCCAGCCGG - Intronic
902995298 1:20220317-20220339 TCCAAGTGCCCCCATTTAGTTGG + Intergenic
904109909 1:28117666-28117688 CCCAAGAGCCCAGAGCTACTTGG + Intergenic
904721833 1:32516018-32516040 CCCAGGAGCCTCCACCTCATGGG - Intronic
909131461 1:71742258-71742280 TCCAAGAGCCCCCACCATGAAGG - Intronic
912637911 1:111315773-111315795 CCCAAGATCACACAACTAGTAGG + Intronic
913582920 1:120244943-120244965 CCCAAGATCGCACAGCTAGTTGG - Intergenic
913625252 1:120653417-120653439 CCCAAGATCGCACAGCTAGTTGG + Intergenic
914564851 1:148856439-148856461 CCCAAGATCGCACAGCTAGTTGG - Intronic
914607975 1:149273803-149273825 CCCAAGATCGCACAGCTAGTTGG + Intergenic
914804639 1:150983173-150983195 CCCAACAGCCCCTACCTTGCTGG - Exonic
917442643 1:175080626-175080648 CCCATGAGCCCCCATCTAGCAGG - Intronic
918378543 1:183932834-183932856 CCCATGAGTCCCCACCTCCTTGG + Intronic
920409658 1:205749608-205749630 CCCAAGAGGCCCCACCTCCTCGG - Intronic
1063273416 10:4537460-4537482 CCCAAGATCACCCACAGAGTTGG + Intergenic
1066005109 10:31139809-31139831 CCTAAGATCGCACACCTAGTAGG - Intergenic
1068928770 10:62567257-62567279 CCCAAGATCACACAGCTAGTAGG + Intronic
1069916210 10:71788877-71788899 GCAAAGTGCCCCCACCTAGGTGG - Intronic
1070325252 10:75384694-75384716 CCCCAAAGCCCCCACCTGGTTGG + Intergenic
1072303696 10:94086567-94086589 TCCAAGACCCCCACCCTAGTGGG - Intronic
1073729514 10:106271932-106271954 TGCAACAGCCCCCACCTATTTGG + Intergenic
1074161692 10:110841137-110841159 TCCAAGTGCCCTGACCTAGTAGG - Intergenic
1074669958 10:115779096-115779118 CCCAATGTCCCCCACCTGGTAGG + Intronic
1075407643 10:122205241-122205263 CCCAGGAACCCCCACCGGGTGGG - Intronic
1075930423 10:126290271-126290293 CCCCAGAGCCTCCACCAAGAAGG + Intronic
1076008821 10:126969953-126969975 CCCAACAGCCTCTACCTAATAGG - Intronic
1076251002 10:128983766-128983788 CCCAGGAGCCCCCAGCAAGGTGG - Intergenic
1083690511 11:64405560-64405582 CCCAAGGTCCCACAGCTAGTTGG - Intergenic
1084611541 11:70206322-70206344 CCTGAGAGCCCCCACCAGGTGGG - Exonic
1085503962 11:77045344-77045366 ACCAAGAGCCGCCACATGGTCGG - Intergenic
1086371789 11:86162562-86162584 CCCAAAGGCCTGCACCTAGTAGG - Intergenic
1086819923 11:91423213-91423235 CTCCAGAGCCCCAACCTAGTTGG + Intergenic
1092104412 12:5911228-5911250 CCCAGGACCCAGCACCTAGTAGG + Intronic
1104920053 12:132286010-132286032 CCCAGGAGCCCGCAGCTCGTGGG + Intronic
1112678203 13:101729507-101729529 CCCAAGAACACACAGCTAGTGGG - Intronic
1119663226 14:76465973-76465995 GCCAAGAGCCCCCACCTGGCAGG - Intronic
1121273125 14:92651162-92651184 CCCCAGAGCACCCAGCTGGTTGG + Intronic
1121861659 14:97324371-97324393 CCCAAGAGCTCCCACCTTGAGGG - Intergenic
1122610810 14:102982038-102982060 CCCAAGAGCCCACAGGTGGTCGG + Intronic
1122649611 14:103219385-103219407 CACAAGAGCCCCAACCTCCTGGG + Intergenic
1125429616 15:39581573-39581595 CCCAAAAGCCCCCAAATTGTTGG + Intronic
1125591867 15:40859284-40859306 CCCGAGAGCTCCCACCTCCTCGG - Intergenic
1130905949 15:88241033-88241055 CCCAAGAGCCCCCACCTAGTAGG - Intronic
1130975299 15:88769226-88769248 CCCAAGGGCCCCCTCCTGGGGGG + Intergenic
1134388892 16:13800349-13800371 CCCCTGAGCCCCCACCTACTAGG + Intergenic
1138422644 16:56909576-56909598 CCAAAGAGGCCCCAGCTATTGGG + Intronic
1141423775 16:83932791-83932813 CCCAGGAGCCTCCACCTAACAGG - Intronic
1141884515 16:86882517-86882539 AACAACAGCCCCCACCTATTGGG - Intergenic
1142205313 16:88780087-88780109 CCCACGAGCCGCCACCAGGTCGG + Intronic
1145890211 17:28408836-28408858 CCCAAGAATCTCCACCTAGAAGG + Intergenic
1147122469 17:38343740-38343762 CCCAGCAGCCCCCACATAGGAGG + Exonic
1148726627 17:49796470-49796492 CCCAAGATGCCACAGCTAGTTGG + Intronic
1150840828 17:68603975-68603997 CCCAAGTGCTCCAACCTTGTAGG + Intergenic
1151213551 17:72562130-72562152 CCCAAGAACCTCCTCCTGGTTGG - Intergenic
1152617207 17:81343461-81343483 CCCAAGGGCCCCCACTGAGGAGG - Intergenic
1158471565 18:57741775-57741797 CCAAAGAGCCCCCATCTAAAAGG + Intronic
1158507815 18:58062219-58062241 CCCAAGTGCACCCACGTACTGGG - Intronic
1160237583 18:77098351-77098373 CCCAAGATCACCCAACTAGCTGG + Intronic
1160527849 18:79547862-79547884 CCCACGAGCCCCCACCACTTTGG + Intergenic
1160712534 19:559127-559149 CCAAAGAGCTCCCACCTGGGGGG - Intergenic
1160717851 19:584502-584524 CCCAGCAGCCCCCACCTAGCAGG - Intergenic
1161417204 19:4153970-4153992 CCCAAGTGCCCGCTCCTAGGAGG - Intronic
1161507084 19:4649911-4649933 CCCAGGAGCCCCCACAAAGCCGG - Intronic
1161975890 19:7607633-7607655 CCCAAGGGACCCCACAGAGTAGG - Intronic
1166734603 19:45076530-45076552 CCCATGAGCCCCGCCCTGGTAGG - Exonic
1167012198 19:46816076-46816098 CCCAAGAGCAACAACCTAGTGGG - Intergenic
926225795 2:10966139-10966161 CCCAAGTGCCCCCAGCTAGCAGG + Intergenic
926632397 2:15148296-15148318 CCAAAGAGGCCACATCTAGTAGG + Intergenic
927275486 2:21258854-21258876 CCCAAGATCACACAGCTAGTGGG - Intergenic
931015272 2:57971225-57971247 TGCAAGAGCCCTCTCCTAGTGGG + Intronic
931758290 2:65393915-65393937 CTCAAGACCCCCCAGCTATTAGG - Intronic
932330948 2:70898003-70898025 CCCAAGAGTCAACACCTAGCTGG + Intergenic
933209139 2:79546016-79546038 CCCAAGATTGCCCAGCTAGTTGG + Intronic
935635009 2:105243390-105243412 CCCAGGAGCTCACACCTACTGGG - Intergenic
937660283 2:124423119-124423141 CCCAAGATTACCCAACTAGTAGG - Intronic
938322196 2:130372801-130372823 CCCAAGACCCCACCCCTAGCGGG - Intronic
942088313 2:172463610-172463632 CCCAAGATCTCACAGCTAGTGGG - Intronic
948420435 2:237856860-237856882 CCTAAGAGCCCACACCCAGCTGG - Intergenic
948641768 2:239379616-239379638 CCCCACAGCCCCCACCTTGGTGG + Intronic
948733078 2:239979570-239979592 CCCGAGAGCCCCCACTTAACAGG - Intronic
1173001871 20:39110665-39110687 CCCAGGAGCTTCCACCTAGTGGG + Intergenic
1173330655 20:42073710-42073732 CCCAAGTGCCCCCACTGAGCAGG - Exonic
1173390637 20:42629408-42629430 CTCAATAGCACTCACCTAGTTGG - Intronic
1175048093 20:56126299-56126321 CCCAAGACCACCCAGCTTGTAGG + Intergenic
1175142698 20:56872723-56872745 CCCAAGAGCTCCTTCCTACTTGG + Intergenic
1175394044 20:58646458-58646480 CCCAACAGGCCCCACCTAAATGG - Intergenic
1175974483 20:62703583-62703605 CTCAAGGGCTCACACCTAGTGGG - Intergenic
1177169741 21:17641805-17641827 CCCAACAGGCCCCACCTGGGAGG + Intergenic
1178346323 21:31831614-31831636 CACAAGAGCCACCAACTTGTAGG + Intergenic
1179981644 21:44899052-44899074 CCCAACAGCACTCACCTCGTAGG + Exonic
1182467260 22:30525255-30525277 ACCAAGGGCCCTCACCTGGTAGG + Intronic
1183331746 22:37226011-37226033 CCCCAGCGCTCCCACCTAGATGG - Exonic
1183334009 22:37236462-37236484 CCCAAGATCTCCCAGCCAGTGGG + Intronic
1184262772 22:43328922-43328944 CCCAAGATCACCCAGCTAGAAGG + Intronic
1184431939 22:44446116-44446138 CCCAAGATCCCCCAGCTGGCCGG - Intergenic
1184900885 22:47445769-47445791 ACCAAGAAGCCCCACCTTGTGGG - Intergenic
1185237116 22:49720529-49720551 CCCAGCAGCCCCCACCTCCTGGG + Intergenic
950448257 3:13050629-13050651 CCCAAGGGCACTCAGCTAGTAGG - Intronic
950893831 3:16430184-16430206 CCCAGGAGCCTCCAGCTCGTGGG + Intronic
953344565 3:42164619-42164641 CCCAGGAGCACCCACCTCATGGG - Intronic
960967354 3:123114503-123114525 CCCAAGATCACCCAGCCAGTGGG + Intronic
961440953 3:126952860-126952882 TCCCAGAGCCCCCACCCTGTCGG - Intronic
963349206 3:144132036-144132058 CCCACTAGGCCCCACCTGGTGGG + Intergenic
969292449 4:6248706-6248728 CACATGCGCCCCCTCCTAGTGGG + Intergenic
969641125 4:8399378-8399400 CCCAAGAGTCCCCTTCTAGCGGG + Intronic
970687419 4:18584350-18584372 CCCAAGACTCACCACGTAGTGGG - Intergenic
970733220 4:19133510-19133532 CACAATAGCTCCCACATAGTAGG + Intergenic
974534358 4:63155145-63155167 CCCAACTGCCCCCACACAGTTGG + Intergenic
974679481 4:65142450-65142472 TCCGAGAGCCCCCAGCTAATTGG + Intergenic
976274398 4:83261442-83261464 CCCAAGAGCAACCAACTGGTAGG + Intergenic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
985142669 4:186858693-186858715 CCTAAGTTCCCACACCTAGTAGG + Intergenic
986740428 5:10700704-10700726 CCCAGGAGCCACCACCCAGATGG + Intronic
990447769 5:55908561-55908583 GCCAAGAGCACCCACCTTTTGGG + Intronic
996672749 5:126137380-126137402 ACCAAGAGCCCCTACCCAGGAGG - Intergenic
997383201 5:133452024-133452046 CCCAGGAGCCCACACCTGGCTGG + Intronic
997743129 5:136275274-136275296 CCCAAGGTCACCCAACTAGTAGG - Intronic
1003245532 6:4378951-4378973 CCCAAAAGCCCCCAATTTGTGGG + Intergenic
1004899412 6:20180467-20180489 CCCAAGAGTCCCCACTGGGTAGG - Intronic
1007385688 6:41518801-41518823 CCCAAGATCACCCAGCTGGTGGG - Intergenic
1007688636 6:43683041-43683063 CCCAAGTGCCTCCACCAAGCAGG - Intronic
1008055761 6:46944414-46944436 AACAAGAGTCCCCACCTTGTGGG - Intronic
1011443523 6:87412532-87412554 CCTATGAGCCCCCACATAGATGG - Intronic
1013082279 6:106823163-106823185 CCCACGAGCCCTCACCTAGAAGG - Intergenic
1020013319 7:4817895-4817917 CACAAGAGCCCCCACCCAGACGG - Intronic
1026330908 7:69351756-69351778 CCCAAGAACACCCACCTGGAGGG + Intergenic
1032078271 7:128846342-128846364 CCCAAGAGCCCCTTCCGAGTGGG + Exonic
1033660288 7:143397905-143397927 CACAAGATACCCCACCTGGTGGG + Exonic
1037589281 8:20299883-20299905 CTCAAGATTCCCCACGTAGTTGG + Intronic
1037754109 8:21700407-21700429 GCCAGGAGCCCCCTCCCAGTTGG - Intronic
1042224246 8:66503175-66503197 ACCAAGAGCACCCACTTAGGAGG + Intronic
1043107969 8:76139006-76139028 CCTAATAGCACCCACCTAATTGG + Intergenic
1045049107 8:98306696-98306718 CCCAAGGTCACCCAGCTAGTTGG - Intergenic
1046318508 8:112538836-112538858 CTCAAGAGCACCCACCAAGATGG - Intronic
1048163768 8:132044105-132044127 CCCAAGACCACCCAGCTAGAAGG - Intronic
1049107716 8:140624168-140624190 CCGAAGAGCCCCCACCCAGCAGG + Intronic
1053303127 9:36965738-36965760 GCCAAGAGCTCCCACCTGGTGGG - Intronic
1054830424 9:69618874-69618896 CCTAAGATACCCCAGCTAGTAGG - Intronic
1057131291 9:92656176-92656198 CTCAAGAGCCCTCACCCAGCAGG + Intronic
1060229975 9:121819126-121819148 CCCAACAGACCCCTCCCAGTGGG - Intergenic
1061986419 9:134132663-134132685 CCCAAGGACCCACAGCTAGTGGG - Intergenic
1062052179 9:134453306-134453328 CCACAGAGCCCCCACCCAGAGGG - Intergenic
1197719723 X:129737072-129737094 CCCAAGATCACACAGCTAGTGGG + Intergenic
1198342840 X:135732047-135732069 CCCAAGAATCCCCACCCATTTGG - Intergenic
1198345149 X:135751248-135751270 CCCAAGAATCCCCACCCATTTGG + Intergenic
1199980915 X:152919964-152919986 CCCAAGAGCACTCACCTAGCAGG - Intronic