ID: 1130907033

View in Genome Browser
Species Human (GRCh38)
Location 15:88247982-88248004
Sequence TGGGGTGCCAGGAGCATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130907033_1130907042 25 Left 1130907033 15:88247982-88248004 CCAGAAATGCTCCTGGCACCCCA 0: 1
1: 0
2: 0
3: 15
4: 195
Right 1130907042 15:88248030-88248052 AGCCCTCTGCTCTCCCATCCAGG 0: 1
1: 0
2: 4
3: 34
4: 332
1130907033_1130907035 -10 Left 1130907033 15:88247982-88248004 CCAGAAATGCTCCTGGCACCCCA 0: 1
1: 0
2: 0
3: 15
4: 195
Right 1130907035 15:88247995-88248017 TGGCACCCCAAAGCTCTACCTGG 0: 1
1: 0
2: 0
3: 10
4: 89
1130907033_1130907036 -9 Left 1130907033 15:88247982-88248004 CCAGAAATGCTCCTGGCACCCCA 0: 1
1: 0
2: 0
3: 15
4: 195
Right 1130907036 15:88247996-88248018 GGCACCCCAAAGCTCTACCTGGG 0: 1
1: 0
2: 0
3: 1
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130907033 Original CRISPR TGGGGTGCCAGGAGCATTTC TGG (reversed) Intronic
900487616 1:2930929-2930951 GGGGGTGCCAGGGGCCTTTATGG + Intergenic
900686762 1:3953797-3953819 CGGGCTTCCAGGGGCATTTCGGG - Intergenic
901450986 1:9337052-9337074 TAGAATGCCAGGAGCATTTGGGG - Intronic
901706784 1:11079624-11079646 TGAGGTGGCTGGATCATTTCAGG - Intronic
901827583 1:11872426-11872448 TGGGGTGGGAGGATCATTTGAGG - Intergenic
902937120 1:19772496-19772518 TGGGGAGCCCAGAGCATTTGGGG + Intronic
904012396 1:27397347-27397369 TGGGGCTCTTGGAGCATTTCTGG + Intergenic
904114271 1:28150058-28150080 TGGTGGCCCGGGAGCATTTCCGG + Exonic
904616094 1:31750728-31750750 TGGGGTGCAAGAAGCACTGCTGG - Intronic
904884216 1:33724367-33724389 TGGGGTCCCAGGAGGATGACGGG - Intronic
908645723 1:66275735-66275757 TCGGAAGCCAGGAGCATTTCAGG + Intronic
909950279 1:81711804-81711826 TGGGGTCCCTGGACCCTTTCAGG - Intronic
911464960 1:98239870-98239892 GGGGGTACCAGCAGCACTTCTGG + Intergenic
912551890 1:110490079-110490101 TGGGGTGGCAGGAGGGGTTCTGG + Intergenic
913364597 1:118022810-118022832 TGGGGTGACAGGTGGAGTTCTGG + Intronic
917452395 1:175157927-175157949 TGGGTTGCCAGTGGCAGTTCAGG + Intronic
921340200 1:214126941-214126963 TGGGGATCCAGGAGCAACTCAGG - Intergenic
923444695 1:234058575-234058597 TGAGGTGGGAGGATCATTTCAGG - Intronic
923535610 1:234849039-234849061 TGGGTTGGCATGAGCATTGCCGG + Intergenic
923566963 1:235083596-235083618 TGCGGTGCCAGGGGCTTTGCAGG - Intergenic
924725746 1:246668945-246668967 TGGGGTGCCGGGAGGATATGGGG + Intergenic
1064312468 10:14223641-14223663 TGAGGTGAGAGGATCATTTCTGG + Intronic
1064633987 10:17345231-17345253 TGAGATGCCTGGAGCATTTCAGG + Intronic
1064947221 10:20804619-20804641 TGGGGTGGCAGAAGTATTCCAGG + Intronic
1067570466 10:47367849-47367871 CTGTGTGCCAGGAGCACTTCCGG - Exonic
1069504794 10:68988311-68988333 TGGGATGCCAGTAACATTTTGGG - Intergenic
1069738882 10:70674874-70674896 TGGAGTGGCAGGAGGATTTTCGG + Exonic
1070492043 10:76986513-76986535 AGGGTTTCCAGGAGCAATTCTGG + Intronic
1070711570 10:78686885-78686907 GGGTGTGCCTGGAGCATTTGAGG + Intergenic
1072267990 10:93748836-93748858 GGGGGTGCTAAGAGCATTTGGGG + Intergenic
1072484769 10:95844552-95844574 CAGGGTGCCAGGATCATTACTGG + Exonic
1072713822 10:97736309-97736331 TTGAGTGCCAGGGGCATTTGAGG + Intergenic
1076171603 10:128324632-128324654 TGTGGGGCCAGGAGCACTTGAGG - Intergenic
1076599811 10:131650306-131650328 TGGGGTTCCAGGAGCAATCAGGG - Intergenic
1080615256 11:33940076-33940098 TTGGGTCCCAGAAGCATTTCTGG + Intergenic
1083677160 11:64332532-64332554 TGGGGTGCCAGGCGGAGCTCCGG + Intergenic
1084351506 11:68603283-68603305 TGGGGTGCCAGTTCCTTTTCGGG + Intronic
1085714749 11:78862638-78862660 TGGGGTGAGAGGAGCTCTTCTGG - Intronic
1086927839 11:92659810-92659832 TGGGTTGCCAAGAGCATCTCAGG + Intronic
1087066448 11:94032180-94032202 TGGGGAGCTGGAAGCATTTCAGG - Intronic
1089006623 11:115096961-115096983 TGAGTTGGCAGGAGGATTTCTGG - Intergenic
1091999522 12:5020826-5020848 TGGGGTGGCAGGAGAATGCCTGG - Intergenic
1092861422 12:12723591-12723613 TGGGGTGCCTGCAGCAATCCAGG - Intergenic
1094481328 12:30884537-30884559 TGGGGTCCCAGCAGAATTCCTGG - Intergenic
1096743351 12:53710324-53710346 GGGGTGGACAGGAGCATTTCAGG + Intronic
1097186713 12:57200071-57200093 TGGGGTCCAAGGAGGATTTGGGG - Intronic
1098017808 12:66124958-66124980 TGGGGTGGGAGGATCATTTGAGG + Intronic
1098286801 12:68915410-68915432 TTGGGTGGCAGGAGCAGTCCAGG - Intronic
1101616243 12:106340548-106340570 TGGGGTTGCAGGTGCATTTTTGG + Intronic
1103217104 12:119210340-119210362 TGGTGTGCCAGGGGCATTCATGG - Intronic
1103713880 12:122932015-122932037 TGGGGAGCCAGGAGCCACTCTGG - Intronic
1104331329 12:127848994-127849016 TGAGGTGCCTGGATCATTTGAGG - Intergenic
1112591011 13:100763067-100763089 TGGGATGCCAGGAATATTTCTGG + Intergenic
1113145030 13:107199062-107199084 TGGGGTGCCATGAGGCTTTTAGG + Intronic
1113145041 13:107199119-107199141 TGGGGTGCCATGAGGCTTTTAGG + Intronic
1114073133 14:19131595-19131617 TGGGGTCCCAGGAGGGATTCCGG - Intergenic
1114089133 14:19268388-19268410 TGGGGTCCCAGGAGGGATTCCGG + Intergenic
1114211995 14:20623408-20623430 TAGGCTCCCAGGAGAATTTCTGG + Intergenic
1114622772 14:24107173-24107195 TGGGGTTCCAGGCACCTTTCTGG + Intronic
1116512434 14:45763202-45763224 TGTGGTGCTAGGATAATTTCAGG + Intergenic
1118836570 14:69482579-69482601 TGGGGTGGCAGCAGCATGTGTGG - Intergenic
1118956526 14:70488186-70488208 TGGGGTGCAGAGAGCATGTCTGG + Intergenic
1120023876 14:79560421-79560443 GGGGGTGGGAGGAGCATTTCTGG + Intronic
1123112307 14:105878759-105878781 TGGGGGGCCAGGGGCATGGCGGG - Intergenic
1125641653 15:41236174-41236196 TGGGGTGGAAGGATCATTTGAGG - Intronic
1125967924 15:43889090-43889112 TAGGGTGACAGGAGGATTTCGGG + Intronic
1126049071 15:44670531-44670553 TAAGGTGCCAGCATCATTTCTGG - Intronic
1130907033 15:88247982-88248004 TGGGGTGCCAGGAGCATTTCTGG - Intronic
1131131947 15:89905911-89905933 TGAGTTGCCAGGAGCACTGCTGG - Intronic
1132987244 16:2773899-2773921 GGGAGTGCCAAGAGCATATCTGG - Intronic
1134246775 16:12545890-12545912 TGGGGTACCTGGAGCATTCTAGG + Intronic
1134871412 16:17655466-17655488 AGGGATGGGAGGAGCATTTCTGG - Intergenic
1135584649 16:23659813-23659835 TAGGGTACCAGGAGGTTTTCTGG - Intronic
1135880110 16:26247291-26247313 AGGGGTGAAAGGAGCATTTTTGG - Intergenic
1137001591 16:35234575-35234597 AGGGGTGCCAACAGCATTTTTGG - Intergenic
1137017882 16:35394442-35394464 AGGGGTGCCAACAGCATTTTTGG - Intergenic
1137764218 16:50965387-50965409 TGGGGTCCCAGCAGCATGGCTGG - Intergenic
1138416446 16:56874292-56874314 AGGGGTTCCAGCAGAATTTCTGG + Intronic
1141229239 16:82149232-82149254 TGGGGTAAGAGGAGCATTCCTGG + Intronic
1141661720 16:85445102-85445124 TGGGGTGCCACCAGCGATTCAGG - Intergenic
1142020150 16:87777196-87777218 TGGGGTGCCAGGCACGTTTTGGG - Intergenic
1142560211 17:805140-805162 TGGGGTGCCAGGGGAACTCCCGG + Exonic
1145841541 17:27999399-27999421 TGAGGTGGCAGGATCATTTGTGG - Intergenic
1147850701 17:43440361-43440383 GGAGGTGCCAGGATCCTTTCTGG + Intergenic
1148801568 17:50230067-50230089 TGAGGTGCGAGGATCATTTGAGG - Intergenic
1149498531 17:57134388-57134410 TGGGGTTCTGGGAGCCTTTCTGG - Intergenic
1150229752 17:63543601-63543623 TTGGCTGCCAGGAGCCTGTCGGG - Exonic
1150359951 17:64523202-64523224 TGTTGTGCCAGGCGCAGTTCTGG + Intronic
1151572393 17:74933349-74933371 TGTGGAGAGAGGAGCATTTCAGG - Intronic
1152552813 17:81038297-81038319 TGGAATGCCAGGAGAATGTCAGG + Intronic
1152795795 17:82305535-82305557 TCAGGTGCCCGGAGCAGTTCTGG + Intergenic
1153786121 18:8537065-8537087 GGGGCTGCCAGGAGCATGGCAGG + Intergenic
1156516695 18:37686173-37686195 GGGGGTGCCAAGGGCACTTCTGG + Intergenic
1158932053 18:62332164-62332186 AGTGGTGCCAGTAGGATTTCTGG - Intronic
1159917079 18:74197695-74197717 TGGGAGGGGAGGAGCATTTCCGG - Intergenic
1160719738 19:591901-591923 TGGGGTGGGAGGAGGATTCCAGG - Intronic
1164734469 19:30530746-30530768 TGGGGTGCCAGGAGAAGTGATGG + Intronic
1167527571 19:49994602-49994624 TGGGGGGCCATGAGCATTGGAGG - Intronic
926267601 2:11339497-11339519 AGTGTTGCTAGGAGCATTTCTGG - Intronic
926632353 2:15148021-15148043 AGGGGTGCAAGAAGCATGTCTGG - Intergenic
927430028 2:23019640-23019662 TGGGAGGGCAGGAGCATTTCTGG - Intergenic
929824350 2:45298722-45298744 TGGGGAGCCAGGCGGATCTCAGG + Intergenic
929948594 2:46389141-46389163 GGGGGTGACAGGATCATTTTTGG - Intergenic
932671831 2:73743895-73743917 TGGGGTGCAGGGTGCAATTCTGG - Intergenic
935836193 2:107056846-107056868 TGGGATGGCGGGAGCATTTTTGG + Intergenic
936234910 2:110733859-110733881 GGGGGACCCAAGAGCATTTCAGG + Intronic
940341184 2:152583312-152583334 TGGGGTCCCACCAGCATTTGAGG - Intronic
940926976 2:159374981-159375003 TGAGGTGGCAGGATCATTTGAGG + Intronic
945098194 2:206239283-206239305 TGGGGGTGCAGGAGCCTTTCAGG + Intergenic
947752721 2:232541189-232541211 GGGGGTGGCAGGAGGATTGCTGG + Intronic
948730893 2:239963122-239963144 TTGGGTGCCAGGAGAATTCTGGG + Intronic
948901196 2:240957709-240957731 TGGGCTGCCAGGAGCTCCTCTGG - Intronic
1172490108 20:35329601-35329623 GGGTGTGCCATGAGTATTTCTGG - Intronic
1177740203 21:25145196-25145218 TGGGGAGGCAGGAGAATTGCTGG + Intergenic
1179631250 21:42680037-42680059 TGGGGTGCCAGGAGCCTGGGCGG + Intronic
1180088317 21:45518427-45518449 TGGGGTTCAAAAAGCATTTCAGG + Intronic
1180491574 22:15853948-15853970 TGGGGTCCCAGGAGGGATTCCGG - Intergenic
1180609644 22:17086770-17086792 GGGGGTAGCAGGAGCATTCCAGG + Intronic
1182365616 22:29776991-29777013 TGGGGTGCCAGAAGCTTCTAGGG - Intergenic
1182546661 22:31080800-31080822 TGGAGTGCCGGGACCATCTCAGG - Intronic
1183046204 22:35222467-35222489 TGGGGGTGCAGGAGCATTTTTGG - Intergenic
1183348376 22:37320205-37320227 TGGGGTGCCTGGAGCAGTCCTGG - Intergenic
1183399891 22:37596579-37596601 GGGGGTTCCAGGAGTATTTCTGG - Intergenic
1183708764 22:39490459-39490481 TGGGGGACCAGTAGCATCTCTGG + Exonic
1185199208 22:49491605-49491627 AGGGGCGCCAGGAGCACTTGGGG - Intronic
949173915 3:1035153-1035175 TGGGGTTCCAGGAGCCACTCGGG + Intergenic
950030913 3:9852779-9852801 TGTGGTGCTGGGAGCATTCCTGG + Intronic
951264764 3:20552658-20552680 TTGGGTGCCAGGAGCATGGGAGG - Intergenic
952283392 3:31945198-31945220 AGGGGTGCCAGGGTCATTTTGGG + Intronic
954275580 3:49539771-49539793 TGGACTGCCAGGAGCAGCTCTGG + Intergenic
957035176 3:75287771-75287793 TGGGGTGCCAGGAGCTGATTTGG + Intergenic
961450300 3:126999555-126999577 GGGGGTGCCGGGAGGATGTCTGG - Intronic
961623925 3:128246291-128246313 TGGGGTGTTAGGAGCATCTAAGG - Intronic
961822435 3:129582027-129582049 TGGGGGTCCAGGAGCAGCTCAGG + Intronic
962389484 3:134959300-134959322 GGGTCCGCCAGGAGCATTTCTGG + Intronic
963204621 3:142620018-142620040 TGGGCAGCCAGGAGTAATTCTGG - Intronic
964244042 3:154629997-154630019 TGGAGTTTCAGGAGCATTGCTGG + Intergenic
964798048 3:160521364-160521386 TGGGGTGGAAGGATCATTTGAGG + Intronic
969876509 4:10139539-10139561 GGGGGTCCCAGGAGCATCTTGGG + Intergenic
975127822 4:70801850-70801872 TGGGCTTCCAGGTGCCTTTCAGG + Intronic
978358774 4:107906298-107906320 TGTGGCACCAGGACCATTTCGGG + Intronic
978443870 4:108762649-108762671 CCGGGTTCCAGGAGCGTTTCTGG + Intronic
979490642 4:121323337-121323359 TTAGGGGCCAGTAGCATTTCAGG + Intergenic
983263761 4:165486109-165486131 TGGGGTGCCAGCAGGAATTGGGG + Intronic
984862052 4:184250184-184250206 TGAGGTGTCAGGAGCATATCTGG + Intergenic
985874746 5:2586171-2586193 TTGGCTGCCCAGAGCATTTCTGG - Intergenic
987822986 5:22990622-22990644 TGTGGTGCAGGGAGCATCTCTGG + Intergenic
988592826 5:32563832-32563854 TGGGGAGCCTGGAGCTATTCTGG - Intronic
989242540 5:39217524-39217546 TGCTGTGCTAGGAGCTTTTCAGG + Intronic
990085930 5:51977453-51977475 AGGGGTGCCAGGACAATATCAGG - Intergenic
992543073 5:77783561-77783583 CTGGGGCCCAGGAGCATTTCTGG - Intronic
998151628 5:139760659-139760681 TAGGGTGCCAGGAGCCTGCCTGG - Intergenic
999307151 5:150526994-150527016 TGGGGTGCTAGGGGCATATGGGG + Intronic
999664240 5:153896033-153896055 TGAGCTGCCAGGACCATGTCAGG + Intergenic
1001402494 5:171453949-171453971 AGGGGTGCCCCGAGCATTTGGGG - Intronic
1001631385 5:173177960-173177982 TGGGGTGCCCAGAGCAGTTTCGG + Intergenic
1001698433 5:173689826-173689848 TGGGGTGCCAGGCCCATATCAGG - Intergenic
1002103571 5:176869122-176869144 TGGGGGCCCAGGGGCATGTCTGG + Intronic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005812752 6:29529468-29529490 TGGGGCCCCAGGAGCCTCTCAGG + Intergenic
1006922138 6:37634045-37634067 AGGGGTGGAAGGAGCATTCCAGG + Exonic
1007137003 6:39531959-39531981 TGTGGTGGAAGGAGCATTTTAGG - Intronic
1007500702 6:42294694-42294716 TGGGGTGCCAGGGTTATTGCGGG - Intronic
1007626716 6:43250765-43250787 TGTGTTGCCAGGAGCCTTTGGGG + Intronic
1009266147 6:61557098-61557120 TGGGGTCCCAAGACTATTTCAGG - Intergenic
1011660741 6:89591981-89592003 TGCGAGGCCAGGAGCATTGCTGG + Intronic
1012827540 6:104164743-104164765 TGTGGTGCCAAGAGCATCTCTGG + Intergenic
1012990612 6:105922194-105922216 TGTGGTTCCAGGAGCATGTGAGG - Intergenic
1013370480 6:109466368-109466390 TCAGATGCCAGCAGCATTTCTGG - Exonic
1013611284 6:111798477-111798499 CGGAGTGCCAGGAGCATGACAGG - Intronic
1014790700 6:125668677-125668699 TGGGATGCCAGGGCCAATTCTGG + Intergenic
1016132035 6:140486057-140486079 TGAGGTTTCAGGAGAATTTCAGG - Intergenic
1019514112 7:1432307-1432329 TGGGGTGCCAGGTGCGCTCCAGG - Intronic
1020850937 7:13351657-13351679 TGGGGTGGGAGGATCATTTGAGG + Intergenic
1021571338 7:22068275-22068297 TGGAGTGCCTGGAGCAGATCAGG + Intergenic
1023880035 7:44313112-44313134 TGGGATGCCAGGAGCCCATCAGG - Intronic
1030100453 7:105940950-105940972 TAGGGTTCCAGGAGCAGGTCAGG - Intronic
1032651470 7:133883407-133883429 TGGGGTGGGAGGATCATTTGAGG + Intronic
1034244465 7:149634161-149634183 TGGGGTCGTAGGACCATTTCAGG + Intergenic
1034355034 7:150444900-150444922 GGGGCTTCCAGGAGCATTCCAGG - Intergenic
1035060265 7:156063746-156063768 TGGGCTGCCAGCAGATTTTCTGG - Intergenic
1035466825 7:159084730-159084752 TGGGGTACAGGGAGGATTTCGGG + Intronic
1037891787 8:22627532-22627554 TGGGGTCCCAGGGACATATCTGG - Intronic
1038431617 8:27504888-27504910 GGGGGTATCTGGAGCATTTCAGG + Intronic
1039548343 8:38425751-38425773 AGGTGTGCCATGAGCATTACAGG + Intronic
1040387768 8:46925101-46925123 TGGGATGCTGGGAGGATTTCTGG - Intergenic
1041030454 8:53731148-53731170 TGGGGTACCAGGAGGACTTCAGG - Intronic
1042745583 8:72102686-72102708 TGGCCTGCCTGGAGCATTACAGG - Intronic
1045286253 8:100794134-100794156 TGAGGCACCAGGATCATTTCAGG - Intergenic
1045993135 8:108333642-108333664 TGTGGTGCCAAGAGCAAATCTGG + Intronic
1045994929 8:108351756-108351778 TGGGGTCCCGAGAGCATTTCTGG + Intronic
1046074240 8:109298424-109298446 TGGTGTCCCAGTAGCATTTGTGG - Intronic
1049022973 8:139970497-139970519 TGGGGTGCCAGAGGGATCTCAGG - Intronic
1049219940 8:141424565-141424587 TGGGGACCCAGTAGCTTTTCTGG + Intronic
1050712188 9:8477634-8477656 TGGGTTGCCATGAGAATTTAAGG - Intronic
1050931271 9:11330282-11330304 TGGGAAGCCAGGAACTTTTCAGG + Intergenic
1051171657 9:14323106-14323128 TGCGCAGCCAGGAACATTTCGGG - Intronic
1052970456 9:34374078-34374100 TGTGGTGCCAGGAGCAAAGCAGG - Intronic
1061144915 9:128791887-128791909 TGGGGTCCAGGGAGCATTGCAGG + Intronic
1061217433 9:129229914-129229936 AGGGTTCCCAGGAGCATTGCTGG - Intergenic
1062358188 9:136175007-136175029 TGGGGTGTCTGGAGTATCTCGGG + Intergenic
1062576870 9:137212921-137212943 TGGGGTGGCAGGAGCATACGGGG - Intronic
1187357487 X:18590695-18590717 TGGGGTGCCAACAGCATATGTGG + Intronic
1187757752 X:22545801-22545823 TGGGGAGCCAAGGGCATTTTTGG + Intergenic
1188359324 X:29233319-29233341 TGAGGTGCCAGAAGAATATCAGG - Intronic
1190456753 X:50634814-50634836 TGGGATGCCAGCAGCTGTTCAGG + Exonic
1196001900 X:110795612-110795634 TGGGGTGGCAGGGGAATTTGGGG + Intronic
1196399686 X:115300753-115300775 GGTGGTGCCAAGAGCATCTCTGG - Intronic
1197010155 X:121551164-121551186 CAGGGTGCCAAGAGCATCTCTGG + Intergenic
1197449599 X:126594996-126595018 CATGGTGCCAAGAGCATTTCTGG - Intergenic
1200236577 X:154470626-154470648 TGGGCTGCCAGCAGCCTGTCTGG + Intronic