ID: 1130907623

View in Genome Browser
Species Human (GRCh38)
Location 15:88251648-88251670
Sequence AACTCAGCTGGCTCTTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130907623_1130907636 21 Left 1130907623 15:88251648-88251670 CCCACCCAAGAGCCAGCTGAGTT 0: 1
1: 0
2: 1
3: 16
4: 146
Right 1130907636 15:88251692-88251714 AGTTGGACAGAAGCAGCAGCTGG 0: 1
1: 0
2: 2
3: 30
4: 325
1130907623_1130907637 25 Left 1130907623 15:88251648-88251670 CCCACCCAAGAGCCAGCTGAGTT 0: 1
1: 0
2: 1
3: 16
4: 146
Right 1130907637 15:88251696-88251718 GGACAGAAGCAGCAGCTGGCAGG 0: 1
1: 0
2: 3
3: 57
4: 503
1130907623_1130907633 4 Left 1130907623 15:88251648-88251670 CCCACCCAAGAGCCAGCTGAGTT 0: 1
1: 0
2: 1
3: 16
4: 146
Right 1130907633 15:88251675-88251697 CCCTGGTCCTTCTACAGAGTTGG 0: 1
1: 0
2: 1
3: 12
4: 134
1130907623_1130907638 26 Left 1130907623 15:88251648-88251670 CCCACCCAAGAGCCAGCTGAGTT 0: 1
1: 0
2: 1
3: 16
4: 146
Right 1130907638 15:88251697-88251719 GACAGAAGCAGCAGCTGGCAGGG 0: 1
1: 0
2: 3
3: 64
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130907623 Original CRISPR AACTCAGCTGGCTCTTGGGT GGG (reversed) Intronic
900606335 1:3525255-3525277 AACCAAGCTGGCCCTTGGGCAGG - Intronic
901022611 1:6262729-6262751 GCCTCAGCTGGCTCTAGGGCAGG + Intergenic
902838216 1:19060066-19060088 AACTCAGCTGGCTCAGGACTGGG + Intergenic
902906723 1:19563790-19563812 AACTCAGCTCTGTTTTGGGTGGG + Intergenic
904038850 1:27572855-27572877 AAGACAGCTAGCTCATGGGTTGG - Intronic
904121886 1:28204072-28204094 ACCTCAGATTGCTCTTGGCTGGG - Intronic
905303572 1:37002331-37002353 GACTCAGCTGGTTGTTGGGTTGG - Intronic
906163377 1:43667892-43667914 AACTCAGCTGCTTCTGGCGTGGG - Exonic
914827116 1:151144522-151144544 AAGTCTGCTGACGCTTGGGTAGG + Intronic
918570845 1:185989968-185989990 ACCTCAGCTATGTCTTGGGTAGG + Intronic
920718878 1:208368106-208368128 AACTCAGATGGCTCTTTGACTGG + Intergenic
922181166 1:223234048-223234070 GACTCTGCTGCCTTTTGGGTAGG - Intronic
1065506832 10:26438157-26438179 AGTTCAGCTGTCTCTCGGGTGGG - Intergenic
1066436536 10:35401077-35401099 AACTCAGCTGCCACCTGGGCCGG - Intronic
1072381750 10:94879568-94879590 AGCTCAGCTTCCTCTTGGTTGGG + Intergenic
1073348188 10:102800357-102800379 AATTCAGGTGGCTCCTGAGTCGG - Intronic
1074799381 10:116983976-116983998 TACTCAGCTGCCTGTTGGGCTGG - Intronic
1076183926 10:128431869-128431891 AGCTCAGCAGGCTCTCAGGTGGG + Intergenic
1076532490 10:131154333-131154355 AAATCAGCTGGCTGGTGGGGAGG + Intronic
1080663098 11:34313334-34313356 ACCTCAGCTGTCTCCTGGGTAGG + Intronic
1082784927 11:57311526-57311548 GACTCAACTGGCTCCTGGGCGGG - Intronic
1084463474 11:69308975-69308997 AACTCAGCTTCCCCTGGGGTCGG + Intronic
1085302747 11:75467941-75467963 AACACAGAGGGCTCTGGGGTGGG - Intronic
1089032371 11:115345587-115345609 AACTCAGCTGGATAGTGTGTAGG + Intronic
1091683792 12:2547004-2547026 AAGTCACCTGGCTATTGGGTAGG + Intronic
1093423452 12:19000854-19000876 GACTCACCTAGCTCTTGGGTTGG - Intergenic
1094063700 12:26341479-26341501 ATCTTACCTGGCCCTTGGGTTGG + Intronic
1094356235 12:29580673-29580695 CACTCAGCTGGCTCCTGTTTTGG + Intronic
1095710960 12:45287555-45287577 AAAGTAGCTGGCTCCTGGGTAGG + Intronic
1096357218 12:50951383-50951405 AACTCAACTGGCTCTGGAGGGGG - Intergenic
1097289639 12:57903790-57903812 TGCTCAGCAGTCTCTTGGGTTGG - Intergenic
1098072096 12:66686907-66686929 AACTCAGCAGGCTCATGTGATGG + Intronic
1098970449 12:76849255-76849277 TTCTCAGCTCCCTCTTGGGTGGG - Intronic
1103991753 12:124804106-124804128 TGCTCAGATGGCTCCTGGGTGGG - Intronic
1105620959 13:22065520-22065542 AAATGAGCAGGATCTTGGGTGGG + Intergenic
1107535857 13:41330678-41330700 AAATTAGGTGTCTCTTGGGTGGG + Intronic
1108523626 13:51266410-51266432 AACTGAACTGGCTTTGGGGTTGG - Intronic
1110103031 13:71633745-71633767 AACTCACCTGGCTGTTTGATGGG + Intronic
1110375969 13:74794294-74794316 AGCTCAGCTTGCCCTTGGGTGGG + Intergenic
1110495035 13:76158280-76158302 AACACAGCTAGGGCTTGGGTTGG + Intergenic
1111984292 13:95050004-95050026 AACTCATCTTGCTCTTTAGTAGG - Intronic
1113170972 13:107502950-107502972 AACTGGGCTGCCTCTTGGGCTGG - Intronic
1118017305 14:61673122-61673144 CACTCGGCAGGCTCCTGGGTGGG - Intergenic
1118489455 14:66244849-66244871 AAGCCAGATGGGTCTTGGGTAGG + Intergenic
1120219900 14:81720149-81720171 AACTCAGCTTTATCTTGGTTTGG + Intergenic
1122123508 14:99567030-99567052 AACTTGGGTGGCTCTTGGCTTGG - Intronic
1125574509 15:40746096-40746118 AACTCAGCTTCCTCTTTAGTGGG - Intronic
1127585010 15:60370141-60370163 ATCTCAGCTGGCTGTTTGCTTGG - Intronic
1127823578 15:62683136-62683158 AGCTCAGCTGGATCATGGGGAGG + Intronic
1128352209 15:66898716-66898738 AACCCAGCTGGGTCTTGGAGGGG - Intergenic
1128452000 15:67811212-67811234 AACTGGGCTGGGCCTTGGGTAGG - Intergenic
1128671701 15:69578552-69578574 TACTCAGGTGGCTCATGGCTCGG + Intergenic
1128840962 15:70851810-70851832 AACACAGCCAGCTCTGGGGTGGG + Intronic
1129205098 15:74032771-74032793 AAGTGAGCTGGCACTGGGGTGGG + Intronic
1130553297 15:84905509-84905531 AACTCAGCTTTCTGTTGGGTGGG + Intronic
1130907623 15:88251648-88251670 AACTCAGCTGGCTCTTGGGTGGG - Intronic
1131521941 15:93122942-93122964 CACTCAGGTGGCTCTTGTCTGGG + Intergenic
1133231754 16:4370270-4370292 AACTCAGATGGTTCTGGGGCCGG + Intronic
1134369605 16:13610767-13610789 AACTCAGCCTTCTCTTGGCTGGG + Intergenic
1136474624 16:30505105-30505127 AAGGCAGCTGGCTCCTGGGCAGG + Intronic
1136924394 16:34358482-34358504 CACTGAGATGGCTCCTGGGTGGG - Intergenic
1136980179 16:35053324-35053346 CACTGAGATGGCTCCTGGGTGGG + Intergenic
1140323020 16:73972218-73972240 ATCTCTGCTGGCTCTGGGGTGGG + Intergenic
1140808067 16:78551988-78552010 AACAGAACTGGCTCTTGGTTGGG + Intronic
1142056852 16:88003102-88003124 AACCCAGGTGGCTTTTGGCTTGG - Intronic
1143315949 17:6033530-6033552 AAGCCAGGTGGCTCCTGGGTGGG + Intronic
1143661669 17:8328152-8328174 CATTCAAGTGGCTCTTGGGTGGG - Intergenic
1146344294 17:32047834-32047856 CACTCAGCTGACTATTGAGTCGG + Exonic
1147566327 17:41538544-41538566 AAATCATCTGTCTCTTGGCTGGG - Intergenic
1149850297 17:60030022-60030044 ACCTCAGCAGGCTCTTGTTTCGG - Intergenic
1149859869 17:60116502-60116524 ACCTCAGCAGGCTCTTGTTTCGG + Intergenic
1156421416 18:36957415-36957437 AACAGAGCTCTCTCTTGGGTAGG + Intronic
1158441652 18:57479972-57479994 ACCACAGCTGGCACTGGGGTGGG + Exonic
1158953746 18:62521944-62521966 AACTCAGCTGGATCTTTTGAGGG - Intergenic
1159887576 18:73923606-73923628 AACTCAGTGGGCCCTTGGATGGG + Intergenic
1160682963 19:420368-420390 TCCTCAGGTGGCTCTTGGGCTGG - Intronic
1162555477 19:11383463-11383485 AGCTCAGCTGGCCGCTGGGTGGG - Intronic
1165326747 19:35118582-35118604 AACTCTGCTGGGCCTAGGGTAGG + Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
928015997 2:27657624-27657646 AACTCAGCTGGCACTCCTGTCGG - Exonic
931840922 2:66147120-66147142 ATCTCAGGTGCCTCTTGGGGTGG + Intergenic
932743741 2:74313879-74313901 AGGGCAGCTGCCTCTTGGGTTGG - Intronic
935129505 2:100250992-100251014 AAATCCCCTGGCTCTTGGGGTGG + Intergenic
936986238 2:118313654-118313676 ACCTCAGCTGGATCTGGGGCTGG + Intergenic
942061299 2:172230877-172230899 GAGTCAGCTGGCTGGTGGGTTGG + Intergenic
942598089 2:177611439-177611461 AAATCAGCTGGCTCTATGCTGGG + Intergenic
944021117 2:195105726-195105748 TCCTCAGTTGGCTCTTGGCTTGG - Intergenic
947011770 2:225573648-225573670 TACTCAGCTGGCAGTTGGGATGG + Intronic
1169863492 20:10175523-10175545 AACTTGGCTGGCTCTTGGCTGGG + Intergenic
1170341212 20:15329373-15329395 TGCTCATCTGGCACTTGGGTAGG + Intronic
1170808793 20:19657330-19657352 AGTTCAACAGGCTCTTGGGTAGG + Intronic
1173579490 20:44137195-44137217 AAGTCAGCAGGCTCCTGGGCAGG - Intronic
1173822221 20:46026796-46026818 ATCTCAGATGGCTCTTGAGATGG + Intronic
1173843703 20:46175024-46175046 AGCTCAGGTGGCTCTTGTGGTGG + Exonic
1175266077 20:57704278-57704300 AACTCAGTTGTCTTTGGGGTGGG - Intronic
1179874306 21:44260136-44260158 ATCCCAGCTGGCTTTTGGGCAGG + Intronic
1182666748 22:31965677-31965699 AACTCACCTGGCTGTTGCGTGGG + Intergenic
1185222349 22:49635402-49635424 AAGTCAGCGTGCTCCTGGGTGGG - Intronic
949574646 3:5327187-5327209 ATCACAGCTGGCTCTTGGGGAGG - Intergenic
950221790 3:11201750-11201772 AACTCAGCAGGCACTTGGCAAGG - Intronic
950640528 3:14345516-14345538 GACTCAGCTGGCTCTGGGTTGGG + Intergenic
952988878 3:38813564-38813586 AACTCAGCTGGACCTTGGTTAGG - Intergenic
954334539 3:49908699-49908721 TTCTCAGCTGGATCTTGGGCTGG - Intronic
961452893 3:127010448-127010470 CACTCAGCTGGGTGTTGGGGAGG + Intronic
962686554 3:137853464-137853486 TACTCAGCTGGCATTTGGGCTGG + Intergenic
963070647 3:141302594-141302616 ATCTGAGCTGGCTCCTGGGCAGG - Intergenic
966932384 3:184684328-184684350 GACTCTGGTGGCTCCTGGGTGGG + Intronic
968129695 3:196185599-196185621 AAATCAGCTACATCTTGGGTAGG - Intergenic
970441879 4:16086925-16086947 TACTAAGCAGGCTCTTGGGGTGG + Intergenic
971418099 4:26452122-26452144 AACTCAGCTGTGTTTTGGGGTGG + Intergenic
973603994 4:52569059-52569081 AGCTCAACTGGCTGTTGGGGAGG + Intergenic
973822609 4:54676238-54676260 AACTCAGCAGGTTCTTGGGTGGG - Intronic
982955499 4:161760457-161760479 AAATCAGGTGGCTCTGGGTTCGG + Intronic
983503994 4:168532457-168532479 AACTCAGCTTCTTCTTGGATTGG - Intronic
983998434 4:174213626-174213648 AGCTCAGCTGGCTGTTAAGTGGG + Intergenic
985062244 4:186091098-186091120 GACTGAGTCGGCTCTTGGGTGGG + Intergenic
986101005 5:4611451-4611473 AAAACAGGGGGCTCTTGGGTAGG + Intergenic
989081728 5:37630124-37630146 AACTGGGCTGTCTCTTAGGTTGG + Intronic
995538150 5:113157985-113158007 AACCCAGCTGGCTAATGGGTGGG + Intronic
997456965 5:134024885-134024907 AGCTCAGCTGGCTAGGGGGTAGG - Intergenic
997673033 5:135691972-135691994 AACTCACGTAGCTCTTGGGCAGG - Intergenic
1001970746 5:175953235-175953257 AAATCAGCTGGATATTGGCTGGG - Intronic
1002246692 5:177890530-177890552 AAATCAGCTGGATATTGGCTGGG + Intergenic
1004955424 6:20723243-20723265 AGCTCAGCTGGCCCTTGAGGTGG - Intronic
1005065005 6:21809162-21809184 AGCTCTGCTGGCTCTGGGGCTGG + Intergenic
1006373711 6:33660154-33660176 AGTTCAGATGTCTCTTGGGTGGG + Intronic
1006455495 6:34129660-34129682 GACTCAGCTGTCTCTTGAGCAGG + Intronic
1013485045 6:110588914-110588936 CACTCAGTTGGCTTCTGGGTGGG - Intergenic
1019959721 7:4449191-4449213 GAGTCAGCTAGCTCTTGGGAAGG - Intergenic
1020032260 7:4941120-4941142 TCCTCAGCTAGCTCCTGGGTCGG + Intronic
1020242843 7:6409173-6409195 TACTCTTCTGGCTCTGGGGTCGG - Exonic
1024169360 7:46768298-46768320 AACTAAGCAGCCTCTTGGGCTGG - Intergenic
1024204445 7:47144696-47144718 ATCTCAGCTGGCTCTTTTCTGGG + Intergenic
1030600519 7:111586857-111586879 AATGCAGCTGTCTCTAGGGTCGG + Intergenic
1031876789 7:127150802-127150824 TTCTCAGCTGACCCTTGGGTTGG + Intronic
1032260737 7:130334418-130334440 TACTCAGCTGGCTGCTGGGGAGG + Intergenic
1034521786 7:151625987-151626009 AGCACAGCTGGCTGTGGGGTTGG + Intronic
1034604363 7:152297268-152297290 ATCTCAGCTGACTCCTGAGTTGG + Intronic
1035931830 8:3788424-3788446 ATCTCAGCTGGTTCTTCTGTTGG - Intronic
1035995696 8:4544187-4544209 AACTCAGATGGCTTTAGGTTTGG - Intronic
1037755538 8:21707606-21707628 AGCTGAGCTGACTCTTGGTTTGG - Intronic
1037785356 8:21899726-21899748 AACTTGGCTAGCTCTGGGGTAGG - Intergenic
1045963530 8:107997421-107997443 ATCTCAGCGGGCTTTAGGGTTGG - Intronic
1049624799 8:143615171-143615193 ACCTCAGCAGCCTCCTGGGTGGG - Intronic
1050570959 9:6938540-6938562 AGCTCAGCTGGCTTTTTAGTCGG + Intronic
1052778089 9:32753515-32753537 AATTCCTCTGGCTCTTGGGTTGG + Intergenic
1056021613 9:82443772-82443794 AACTCAGCTGGAAGGTGGGTGGG + Intergenic
1056494408 9:87141793-87141815 AACTCACCTGTCTATTAGGTGGG - Intergenic
1057231788 9:93325663-93325685 ACCTCAGCTGGCTCTGTCGTGGG - Intronic
1059646058 9:116269173-116269195 ATCTCACATGGCTGTTGGGTGGG - Intronic
1060182497 9:121544271-121544293 AACTCAGCAGGATATTGGTTTGG + Intergenic
1187470186 X:19562776-19562798 AATTCAGATGGCTGTTGGCTTGG - Intronic
1188537661 X:31215335-31215357 GACTCAGATGCCTCTTGGGGTGG + Intronic
1188615621 X:32155553-32155575 AACTCTGCTGGATCATGGATTGG + Intronic
1189642008 X:43082929-43082951 TATTCACCTGGCTCTTAGGTTGG + Intergenic
1190435159 X:50417206-50417228 ACATCAGCTGGCTCTTGAGGTGG - Intronic
1191640296 X:63424301-63424323 AGCTCAGGTGGCTCTAGGGAGGG + Intergenic
1193939974 X:87670486-87670508 AACTCAGGTGGCTTTTGTGTAGG - Intergenic
1194286692 X:92019947-92019969 GCCTCATGTGGCTCTTGGGTGGG - Intronic
1195617055 X:106920695-106920717 AACTCCGGTGGCATTTGGGTTGG + Intronic
1197034650 X:121859322-121859344 AACTCAGCCTCTTCTTGGGTGGG + Intergenic
1200142235 X:153908014-153908036 AACTCAGGTGGGTCTTGGGCAGG - Intronic
1200604238 Y:5244507-5244529 GCCTCATGTGGCTCTTGGGTGGG - Intronic
1200746776 Y:6910509-6910531 CCCTCAGCTGGCTGTTGGGGAGG + Intergenic