ID: 1130907632

View in Genome Browser
Species Human (GRCh38)
Location 15:88251675-88251697
Sequence CCAACTCTGTAGAAGGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 121}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130907632_1130907641 14 Left 1130907632 15:88251675-88251697 CCCTGGTCCTTCTACAGAGTTGG 0: 1
1: 0
2: 2
3: 3
4: 121
Right 1130907641 15:88251712-88251734 TGGCAGGGACTGGCAAGGCAAGG 0: 1
1: 0
2: 3
3: 47
4: 733
1130907632_1130907642 19 Left 1130907632 15:88251675-88251697 CCCTGGTCCTTCTACAGAGTTGG 0: 1
1: 0
2: 2
3: 3
4: 121
Right 1130907642 15:88251717-88251739 GGGACTGGCAAGGCAAGGACAGG 0: 1
1: 0
2: 1
3: 34
4: 390
1130907632_1130907638 -1 Left 1130907632 15:88251675-88251697 CCCTGGTCCTTCTACAGAGTTGG 0: 1
1: 0
2: 2
3: 3
4: 121
Right 1130907638 15:88251697-88251719 GACAGAAGCAGCAGCTGGCAGGG 0: 1
1: 0
2: 3
3: 64
4: 543
1130907632_1130907636 -6 Left 1130907632 15:88251675-88251697 CCCTGGTCCTTCTACAGAGTTGG 0: 1
1: 0
2: 2
3: 3
4: 121
Right 1130907636 15:88251692-88251714 AGTTGGACAGAAGCAGCAGCTGG 0: 1
1: 0
2: 2
3: 30
4: 325
1130907632_1130907639 4 Left 1130907632 15:88251675-88251697 CCCTGGTCCTTCTACAGAGTTGG 0: 1
1: 0
2: 2
3: 3
4: 121
Right 1130907639 15:88251702-88251724 AAGCAGCAGCTGGCAGGGACTGG 0: 1
1: 0
2: 8
3: 62
4: 536
1130907632_1130907640 9 Left 1130907632 15:88251675-88251697 CCCTGGTCCTTCTACAGAGTTGG 0: 1
1: 0
2: 2
3: 3
4: 121
Right 1130907640 15:88251707-88251729 GCAGCTGGCAGGGACTGGCAAGG 0: 1
1: 1
2: 8
3: 66
4: 496
1130907632_1130907637 -2 Left 1130907632 15:88251675-88251697 CCCTGGTCCTTCTACAGAGTTGG 0: 1
1: 0
2: 2
3: 3
4: 121
Right 1130907637 15:88251696-88251718 GGACAGAAGCAGCAGCTGGCAGG 0: 1
1: 0
2: 3
3: 57
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130907632 Original CRISPR CCAACTCTGTAGAAGGACCA GGG (reversed) Intronic
900134968 1:1112712-1112734 CCCACCCTGAAGAAGGATCAGGG + Intronic
900639716 1:3682806-3682828 CCAGCTCTGGAGAGGGCCCATGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907705147 1:56826403-56826425 CCAAGGCTGGAGAAGCACCAAGG - Intergenic
912318333 1:108686802-108686824 CCAACTATGTAGCATGGCCAGGG - Intergenic
912475541 1:109932302-109932324 CCAAATCTGTAGAAGCACAGGGG - Intergenic
912977152 1:114341182-114341204 CCTACTGTGTGGAAGGAACATGG + Intergenic
916312510 1:163412614-163412636 CCAACTCTGGACAAGGAGGAAGG + Intergenic
924525801 1:244846859-244846881 CCATCTCAGTAAAAGGACCTCGG + Intronic
924637174 1:245799195-245799217 ACAGCTGTGTAGGAGGACCAGGG - Intronic
1064889916 10:20159521-20159543 TCAAGACTGTAGAAGGACAACGG - Intronic
1066541792 10:36455400-36455422 CCAACTGTGTTGCAGGTCCAAGG - Intergenic
1068714458 10:60172993-60173015 CCCATTCTGTAGAAGGAAGATGG + Exonic
1069656561 10:70093775-70093797 CCACCTCTGAAGATGGGCCAGGG + Exonic
1069810840 10:71158407-71158429 CCAGCTCTGCAGGAAGACCATGG - Intergenic
1075479182 10:122764697-122764719 CCAATTCTGTAGAAAGATCCTGG - Intergenic
1076425450 10:130364277-130364299 CCTGCTCTGGAGAAGGAGCAAGG - Intergenic
1076525151 10:131108017-131108039 CCAACATTGTAGAACAACCAGGG + Intronic
1079161163 11:17995412-17995434 CCAACTCTATACAAGTACCCCGG + Intronic
1080969469 11:37254045-37254067 ACATCTATGTAGCAGGACCACGG + Intergenic
1085072307 11:73558229-73558251 CCAGCACTTTAGAAGGGCCAAGG + Intronic
1085290571 11:75396316-75396338 CCCACTCTATAGACAGACCAAGG + Intergenic
1090043778 11:123313413-123313435 CCTCCTCTGTAGAAGGCCCCGGG + Intergenic
1091225340 11:133953757-133953779 CCTACTCTGTGGGAGGACCCTGG - Intronic
1091665176 12:2413750-2413772 CCTTCTCCGTGGAAGGACCATGG - Intronic
1093823640 12:23653685-23653707 CTCACACTGTAGAAGGAGCAAGG + Intronic
1095968527 12:47885216-47885238 TCAACTCTGTAGAAAGCCCCTGG + Intronic
1097179422 12:57162839-57162861 CCAACTGTGGGGAAGGGCCATGG - Exonic
1099392277 12:82096663-82096685 CTAAATCTGTAGCAAGACCAGGG + Intergenic
1099720111 12:86350379-86350401 CTAACTGTGTAGCAGGTCCATGG + Intronic
1100354498 12:93816755-93816777 CCATCCCTGTAGAATGACAATGG + Intronic
1103519910 12:121531324-121531346 CCAACTTTCTAGAAGCACCCAGG + Intronic
1116897541 14:50331828-50331850 CCAACTCTGACAAAGGATCAGGG + Exonic
1128302454 15:66575094-66575116 CCCTCTCTGAAGAAGGACCCAGG - Intergenic
1128737450 15:70061231-70061253 GCAACTCTGGAGAAACACCAGGG + Intronic
1129790255 15:78336405-78336427 CCAAATATGCAGTAGGACCATGG + Intergenic
1130404180 15:83583378-83583400 CCAACTCTGCAAGAGGACTATGG - Intronic
1130907632 15:88251675-88251697 CCAACTCTGTAGAAGGACCAGGG - Intronic
1131300406 15:91194786-91194808 CCCCCTCTGTGGAAGGATCATGG + Intronic
1132703065 16:1230172-1230194 CCCACTGGGTAGAAGGAACAGGG - Exonic
1132705257 16:1240696-1240718 CCCACTGGGTAGAAGGAACAGGG + Exonic
1133752334 16:8734533-8734555 CCTCCTCTGTAAAAAGACCATGG + Intronic
1139109567 16:63872967-63872989 CCATCTCTATACCAGGACCAAGG - Intergenic
1141908565 16:87043184-87043206 TGAACTCTGTAAAAAGACCAGGG + Intergenic
1142360132 16:89622104-89622126 CCATCTCTGGAGATGGACCCAGG + Intronic
1142618888 17:1153221-1153243 ACAACTAGGCAGAAGGACCAAGG + Intronic
1143167742 17:4906195-4906217 CCAACACTGAAGAAGGATCATGG + Intergenic
1146957117 17:36942347-36942369 CCACCTCCGTAGAAGGAGAAGGG - Exonic
1148036068 17:44661032-44661054 CCAACACTTTGGAAGGCCCAAGG + Intronic
1149113954 17:53069214-53069236 CCAGCCCTGATGAAGGACCAAGG - Intergenic
1150066144 17:62110971-62110993 CCAAGTCTGGAAAAGGACAATGG - Intergenic
1150434342 17:65142312-65142334 CAAACTCTGTAGCATGACCTAGG - Intronic
1151124417 17:71829349-71829371 TCAAAACTGTAGAAGGACTATGG - Intergenic
1152946576 17:83200954-83200976 CCAGCCCAGTGGAAGGACCATGG - Intergenic
1158676183 18:59520390-59520412 TCATCTCTGTTGACGGACCAAGG - Intronic
1163162799 19:15475632-15475654 CAGCCTCTGTAGAAGGACAAGGG + Exonic
1164310309 19:24040269-24040291 CCAGCTCTGAAGAAACACCAAGG - Intronic
1168599611 19:57707358-57707380 CCATCTCAGTTGAAGAACCATGG + Intronic
924968653 2:102122-102144 CCACCTCTTTATATGGACCAAGG - Intergenic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
931858074 2:66324862-66324884 CCACCACTGTAGAAAGATCAGGG + Intergenic
932392616 2:71410458-71410480 CCAACACTTTGGAAGGCCCAGGG - Intronic
933569767 2:83995865-83995887 ACAATTCTGCATAAGGACCAAGG + Intergenic
940628003 2:156200629-156200651 CCAACTCTGGAGAAGTCCCAGGG - Intergenic
942246245 2:174012010-174012032 CCAACTCTGGAGATGGACTTTGG - Intergenic
943382544 2:187170199-187170221 CAAACTCTGTAGCAGCCCCATGG + Intergenic
947438873 2:230099575-230099597 CCAGCTTTGTAAAAGGACAAAGG - Intergenic
947639084 2:231696152-231696174 CCAACTCTGGAGCAAGGCCATGG + Intergenic
948175607 2:235940238-235940260 CCGACGCAGCAGAAGGACCAGGG - Intronic
1168972424 20:1939752-1939774 CCAACCCTGCGGAAGGAGCATGG + Exonic
1176254434 20:64143601-64143623 CCAGCTCTGCAGAGGGAACATGG - Intergenic
1180261606 21:46673849-46673871 CCACGTCTGTATATGGACCAAGG + Intergenic
1180614026 22:17116155-17116177 CCAACTGCCTAGAAGGGCCAAGG + Intergenic
1180684384 22:17653751-17653773 CCAACACTTTGGAAGGACAAGGG - Intronic
1184387350 22:44183573-44183595 CTAGCTCTGTAGAAGGTCCCAGG - Intronic
949835776 3:8268280-8268302 GCAACTCTGGAGAAGTACAAAGG + Intergenic
952474666 3:33695355-33695377 ACAACTCTATAGTAGGCCCATGG - Intronic
953023155 3:39128819-39128841 CCAGCTCTGAAGAAGGAAGAAGG + Exonic
957943526 3:87035099-87035121 CCAACTCTAAAGAAGGATAAGGG + Intergenic
960384204 3:117001234-117001256 CTAGCTCTGTAGAAGGAAAAGGG + Intronic
962866549 3:139452151-139452173 GTAACTCAGCAGAAGGACCAGGG + Intergenic
963250098 3:143095377-143095399 CCAAGCCTGCAGAAGCACCAGGG - Intergenic
964055976 3:152458136-152458158 CCAACAGTGTAGAAGCATCAAGG - Intronic
973623036 4:52746325-52746347 CCAGATCTTTATAAGGACCAAGG + Intronic
975604292 4:76138079-76138101 CTAGCTCTGTAGAAGCTCCATGG - Intronic
978522387 4:109629959-109629981 GCTACTCACTAGAAGGACCAAGG - Intronic
979364261 4:119801870-119801892 CCAACACTGTGGGAGGCCCAGGG - Intergenic
983257036 4:165411448-165411470 CCAACTGTGTAGAATGTCAAGGG - Intronic
984181211 4:176484583-176484605 CAAACTCTGCAGCAGCACCAGGG + Intergenic
986286833 5:6365402-6365424 CCAACTCTGTGGAGAGACCCTGG - Intergenic
990869818 5:60418959-60418981 CCAATTTTGTAGATGTACCATGG + Intronic
993065330 5:83090795-83090817 CCAACTCTGTGCGAGGAGCAGGG + Intronic
994825840 5:104712013-104712035 GTAACTCTGTAGCAAGACCAGGG + Intergenic
997833291 5:137171380-137171402 CCAGCTCTGTATCAGGCCCATGG - Intronic
999289760 5:150416515-150416537 CCAACACTTTAGCAGGTCCAAGG + Intergenic
1000371028 5:160536880-160536902 CCTACTCTGTAGAGAGAGCAGGG - Intergenic
1003094577 6:3132224-3132246 CAAACGCTGCAGAATGACCAAGG - Intronic
1005929408 6:30471899-30471921 CCAAATCTGTAGCAAGGCCAGGG - Intergenic
1006471882 6:34234257-34234279 CCTACTCTGTAGCAGGAACTGGG - Intergenic
1007707231 6:43798333-43798355 CTACCTCAGAAGAAGGACCAAGG - Intergenic
1010572560 6:77495368-77495390 ACACCTCTGTAGAAGTAGCAGGG + Intergenic
1015598704 6:134891816-134891838 CCAACTCTTTATAAGGCCAAAGG - Intergenic
1023995279 7:45155910-45155932 CCAACTCTGTAGAATGGCCAGGG + Intergenic
1026645155 7:72161075-72161097 CTGACTCTGTAGAAGGGACATGG - Intronic
1027526613 7:79277469-79277491 CCAACTCTGTAATATGTCCATGG + Intronic
1030715549 7:112803306-112803328 CCAACACTGTAGGAGGCCTAAGG + Intergenic
1032654261 7:133910432-133910454 ATAACTCTGGAGAAGGCCCATGG - Intronic
1037818736 8:22125432-22125454 CCAGCTCTGAGGAAGGCCCAGGG - Exonic
1039453709 8:37695247-37695269 GCAGCTCTGGAGAAGGACCCGGG + Intergenic
1039484628 8:37900819-37900841 CCAGCTCTGCAGAGGGACCTTGG - Intergenic
1040841587 8:51790744-51790766 TCAACGCTGTAGCAGGAGCAAGG - Intronic
1041004953 8:53488564-53488586 CCATCTTTGCAGATGGACCAAGG + Intergenic
1044203680 8:89466486-89466508 ACAACCCTGTGGAAGGAGCAGGG - Intergenic
1044746515 8:95376260-95376282 CTAACTCTGTGTAAGGCCCAAGG + Intergenic
1048390572 8:133959691-133959713 TCAAATTTGTAGCAGGACCAAGG - Intergenic
1052243391 9:26302757-26302779 CCTCCTCTGTAGATGTACCATGG - Intergenic
1055393046 9:75843823-75843845 CCAACTCTTTGGGAGGACGAAGG + Intergenic
1057079346 9:92160746-92160768 CCAACATTGTAGAACAACCAGGG + Intergenic
1057352795 9:94314929-94314951 GAAACTCTGAGGAAGGACCATGG + Intergenic
1057654952 9:96942662-96942684 GAAACTCTGAGGAAGGACCATGG - Intronic
1057819082 9:98317487-98317509 GCAAGTCTGTAGCAGGACCAAGG - Intronic
1185855598 X:3532017-3532039 CCACCTATGTAGAATAACCAAGG - Intergenic
1186311811 X:8328199-8328221 CCATCCCTGTGGAAGCACCAAGG + Intergenic
1191867135 X:65713293-65713315 CCAACTCAGTGGGAGGACAAAGG - Intronic
1192148721 X:68698699-68698721 CCAACTCTGTAGTAGGCCCACGG - Intronic
1198388622 X:136151055-136151077 GCAACCCTGTAGAAGGTCAAAGG - Intronic
1200880818 Y:8209826-8209848 CCAATGCTCTAGAAGGACTAGGG - Intergenic