ID: 1130912489

View in Genome Browser
Species Human (GRCh38)
Location 15:88280695-88280717
Sequence CACTGGGGGTATGGGAGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130912489_1130912498 4 Left 1130912489 15:88280695-88280717 CCAGTACTCCCATACCCCCAGTG No data
Right 1130912498 15:88280722-88280744 GCAACCACTTTCTGTCTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130912489 Original CRISPR CACTGGGGGTATGGGAGTAC TGG (reversed) Intergenic
No off target data available for this crispr