ID: 1130915667

View in Genome Browser
Species Human (GRCh38)
Location 15:88302666-88302688
Sequence GCACGGTGCCTGGCAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130915662_1130915667 -2 Left 1130915662 15:88302645-88302667 CCACAAAACTGCCCACACTTAGC No data
Right 1130915667 15:88302666-88302688 GCACGGTGCCTGGCAAAAGCAGG No data
1130915660_1130915667 4 Left 1130915660 15:88302639-88302661 CCTCCTCCACAAAACTGCCCACA No data
Right 1130915667 15:88302666-88302688 GCACGGTGCCTGGCAAAAGCAGG No data
1130915657_1130915667 29 Left 1130915657 15:88302614-88302636 CCTTCAAAGCCCAGCTCAGGTGT No data
Right 1130915667 15:88302666-88302688 GCACGGTGCCTGGCAAAAGCAGG No data
1130915659_1130915667 19 Left 1130915659 15:88302624-88302646 CCAGCTCAGGTGTCACCTCCTCC No data
Right 1130915667 15:88302666-88302688 GCACGGTGCCTGGCAAAAGCAGG No data
1130915658_1130915667 20 Left 1130915658 15:88302623-88302645 CCCAGCTCAGGTGTCACCTCCTC No data
Right 1130915667 15:88302666-88302688 GCACGGTGCCTGGCAAAAGCAGG No data
1130915661_1130915667 1 Left 1130915661 15:88302642-88302664 CCTCCACAAAACTGCCCACACTT No data
Right 1130915667 15:88302666-88302688 GCACGGTGCCTGGCAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130915667 Original CRISPR GCACGGTGCCTGGCAAAAGC AGG Intergenic
No off target data available for this crispr