ID: 1130916139

View in Genome Browser
Species Human (GRCh38)
Location 15:88306220-88306242
Sequence CAGGGGCATCTTCAGCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130916130_1130916139 12 Left 1130916130 15:88306185-88306207 CCCACAGGAAGAGTCATGCACAC No data
Right 1130916139 15:88306220-88306242 CAGGGGCATCTTCAGCTGATGGG No data
1130916131_1130916139 11 Left 1130916131 15:88306186-88306208 CCACAGGAAGAGTCATGCACACT No data
Right 1130916139 15:88306220-88306242 CAGGGGCATCTTCAGCTGATGGG No data
1130916126_1130916139 29 Left 1130916126 15:88306168-88306190 CCCAGTGTCTGCAGGTCCCCACA No data
Right 1130916139 15:88306220-88306242 CAGGGGCATCTTCAGCTGATGGG No data
1130916127_1130916139 28 Left 1130916127 15:88306169-88306191 CCAGTGTCTGCAGGTCCCCACAG No data
Right 1130916139 15:88306220-88306242 CAGGGGCATCTTCAGCTGATGGG No data
1130916129_1130916139 13 Left 1130916129 15:88306184-88306206 CCCCACAGGAAGAGTCATGCACA No data
Right 1130916139 15:88306220-88306242 CAGGGGCATCTTCAGCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130916139 Original CRISPR CAGGGGCATCTTCAGCTGAT GGG Intergenic
No off target data available for this crispr