ID: 1130917714

View in Genome Browser
Species Human (GRCh38)
Location 15:88318945-88318967
Sequence ACAGCCCCAGCACTTGCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130917711_1130917714 -10 Left 1130917711 15:88318932-88318954 CCCAACTCTGTCCACAGCCCCAG No data
Right 1130917714 15:88318945-88318967 ACAGCCCCAGCACTTGCCCCCGG No data
1130917707_1130917714 23 Left 1130917707 15:88318899-88318921 CCTGATGCACTCCAGCCTGTAAG No data
Right 1130917714 15:88318945-88318967 ACAGCCCCAGCACTTGCCCCCGG No data
1130917709_1130917714 8 Left 1130917709 15:88318914-88318936 CCTGTAAGTCCTGCAAAGCCCAA No data
Right 1130917714 15:88318945-88318967 ACAGCCCCAGCACTTGCCCCCGG No data
1130917708_1130917714 12 Left 1130917708 15:88318910-88318932 CCAGCCTGTAAGTCCTGCAAAGC No data
Right 1130917714 15:88318945-88318967 ACAGCCCCAGCACTTGCCCCCGG No data
1130917710_1130917714 -1 Left 1130917710 15:88318923-88318945 CCTGCAAAGCCCAACTCTGTCCA No data
Right 1130917714 15:88318945-88318967 ACAGCCCCAGCACTTGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130917714 Original CRISPR ACAGCCCCAGCACTTGCCCC CGG Intergenic
No off target data available for this crispr