ID: 1130918220

View in Genome Browser
Species Human (GRCh38)
Location 15:88322765-88322787
Sequence CTTTGGACTGCTGTGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130918220_1130918233 20 Left 1130918220 15:88322765-88322787 CCTTCTCCCACAGCAGTCCAAAG No data
Right 1130918233 15:88322808-88322830 GGGTGGCTAGATTTCAGCCTAGG No data
1130918220_1130918229 -1 Left 1130918220 15:88322765-88322787 CCTTCTCCCACAGCAGTCCAAAG No data
Right 1130918229 15:88322787-88322809 GCTCAGGCCTGGGAGGGCTCAGG No data
1130918220_1130918230 0 Left 1130918220 15:88322765-88322787 CCTTCTCCCACAGCAGTCCAAAG No data
Right 1130918230 15:88322788-88322810 CTCAGGCCTGGGAGGGCTCAGGG No data
1130918220_1130918231 3 Left 1130918220 15:88322765-88322787 CCTTCTCCCACAGCAGTCCAAAG No data
Right 1130918231 15:88322791-88322813 AGGCCTGGGAGGGCTCAGGGTGG No data
1130918220_1130918226 -8 Left 1130918220 15:88322765-88322787 CCTTCTCCCACAGCAGTCCAAAG No data
Right 1130918226 15:88322780-88322802 GTCCAAAGCTCAGGCCTGGGAGG No data
1130918220_1130918227 -7 Left 1130918220 15:88322765-88322787 CCTTCTCCCACAGCAGTCCAAAG No data
Right 1130918227 15:88322781-88322803 TCCAAAGCTCAGGCCTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130918220 Original CRISPR CTTTGGACTGCTGTGGGAGA AGG (reversed) Intergenic