ID: 1130918221

View in Genome Browser
Species Human (GRCh38)
Location 15:88322771-88322793
Sequence CCTGAGCTTTGGACTGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130918221_1130918231 -3 Left 1130918221 15:88322771-88322793 CCCACAGCAGTCCAAAGCTCAGG No data
Right 1130918231 15:88322791-88322813 AGGCCTGGGAGGGCTCAGGGTGG No data
1130918221_1130918233 14 Left 1130918221 15:88322771-88322793 CCCACAGCAGTCCAAAGCTCAGG No data
Right 1130918233 15:88322808-88322830 GGGTGGCTAGATTTCAGCCTAGG No data
1130918221_1130918230 -6 Left 1130918221 15:88322771-88322793 CCCACAGCAGTCCAAAGCTCAGG No data
Right 1130918230 15:88322788-88322810 CTCAGGCCTGGGAGGGCTCAGGG No data
1130918221_1130918229 -7 Left 1130918221 15:88322771-88322793 CCCACAGCAGTCCAAAGCTCAGG No data
Right 1130918229 15:88322787-88322809 GCTCAGGCCTGGGAGGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130918221 Original CRISPR CCTGAGCTTTGGACTGCTGT GGG (reversed) Intergenic