ID: 1130918228

View in Genome Browser
Species Human (GRCh38)
Location 15:88322782-88322804
Sequence GCCCTCCCAGGCCTGAGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130918228_1130918233 3 Left 1130918228 15:88322782-88322804 CCAAAGCTCAGGCCTGGGAGGGC No data
Right 1130918233 15:88322808-88322830 GGGTGGCTAGATTTCAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130918228 Original CRISPR GCCCTCCCAGGCCTGAGCTT TGG (reversed) Intergenic
No off target data available for this crispr