ID: 1130918232

View in Genome Browser
Species Human (GRCh38)
Location 15:88322794-88322816
Sequence TAGCCACCCTGAGCCCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130918232_1130918236 27 Left 1130918232 15:88322794-88322816 CCTGGGAGGGCTCAGGGTGGCTA No data
Right 1130918236 15:88322844-88322866 CTGAGTTTCCAGCTAGCAACTGG No data
1130918232_1130918233 -9 Left 1130918232 15:88322794-88322816 CCTGGGAGGGCTCAGGGTGGCTA No data
Right 1130918233 15:88322808-88322830 GGGTGGCTAGATTTCAGCCTAGG No data
1130918232_1130918237 28 Left 1130918232 15:88322794-88322816 CCTGGGAGGGCTCAGGGTGGCTA No data
Right 1130918237 15:88322845-88322867 TGAGTTTCCAGCTAGCAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130918232 Original CRISPR TAGCCACCCTGAGCCCTCCC AGG (reversed) Intergenic