ID: 1130918233

View in Genome Browser
Species Human (GRCh38)
Location 15:88322808-88322830
Sequence GGGTGGCTAGATTTCAGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130918228_1130918233 3 Left 1130918228 15:88322782-88322804 CCAAAGCTCAGGCCTGGGAGGGC No data
Right 1130918233 15:88322808-88322830 GGGTGGCTAGATTTCAGCCTAGG No data
1130918220_1130918233 20 Left 1130918220 15:88322765-88322787 CCTTCTCCCACAGCAGTCCAAAG No data
Right 1130918233 15:88322808-88322830 GGGTGGCTAGATTTCAGCCTAGG No data
1130918221_1130918233 14 Left 1130918221 15:88322771-88322793 CCCACAGCAGTCCAAAGCTCAGG No data
Right 1130918233 15:88322808-88322830 GGGTGGCTAGATTTCAGCCTAGG No data
1130918232_1130918233 -9 Left 1130918232 15:88322794-88322816 CCTGGGAGGGCTCAGGGTGGCTA No data
Right 1130918233 15:88322808-88322830 GGGTGGCTAGATTTCAGCCTAGG No data
1130918223_1130918233 13 Left 1130918223 15:88322772-88322794 CCACAGCAGTCCAAAGCTCAGGC No data
Right 1130918233 15:88322808-88322830 GGGTGGCTAGATTTCAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130918233 Original CRISPR GGGTGGCTAGATTTCAGCCT AGG Intergenic