ID: 1130919132

View in Genome Browser
Species Human (GRCh38)
Location 15:88329334-88329356
Sequence ATTCTCTGCACCTCTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130919132_1130919138 19 Left 1130919132 15:88329334-88329356 CCAGCAGCAGAGGTGCAGAGAAT No data
Right 1130919138 15:88329376-88329398 ATTTTCAAGGTCGAGCCAACAGG No data
1130919132_1130919137 6 Left 1130919132 15:88329334-88329356 CCAGCAGCAGAGGTGCAGAGAAT No data
Right 1130919137 15:88329363-88329385 GGACTCTGGATATATTTTCAAGG No data
1130919132_1130919134 -8 Left 1130919132 15:88329334-88329356 CCAGCAGCAGAGGTGCAGAGAAT No data
Right 1130919134 15:88329349-88329371 CAGAGAATCCCGCTGGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130919132 Original CRISPR ATTCTCTGCACCTCTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr