ID: 1130919193

View in Genome Browser
Species Human (GRCh38)
Location 15:88330005-88330027
Sequence CCTTCTCTGCATCATCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130919193_1130919199 8 Left 1130919193 15:88330005-88330027 CCCTGCAGATGATGCAGAGAAGG No data
Right 1130919199 15:88330036-88330058 TAAGGCTCCCCGCTTCTACTAGG No data
1130919193_1130919196 -10 Left 1130919193 15:88330005-88330027 CCCTGCAGATGATGCAGAGAAGG No data
Right 1130919196 15:88330018-88330040 GCAGAGAAGGCTCTCCCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130919193 Original CRISPR CCTTCTCTGCATCATCTGCA GGG (reversed) Intergenic
No off target data available for this crispr