ID: 1130921306

View in Genome Browser
Species Human (GRCh38)
Location 15:88347362-88347384
Sequence TTGTGAGTCTGGAGGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130921302_1130921306 19 Left 1130921302 15:88347320-88347342 CCTCTACTTAAGAACAGTTATGT No data
Right 1130921306 15:88347362-88347384 TTGTGAGTCTGGAGGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130921306 Original CRISPR TTGTGAGTCTGGAGGGAACA AGG Intergenic
No off target data available for this crispr