ID: 1130922184

View in Genome Browser
Species Human (GRCh38)
Location 15:88356999-88357021
Sequence GGGGAAGGAGTTACCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130922182_1130922184 -10 Left 1130922182 15:88356986-88357008 CCATTTCTGGGCTGGGGAAGGAG No data
Right 1130922184 15:88356999-88357021 GGGGAAGGAGTTACCCCAGGAGG No data
1130922175_1130922184 15 Left 1130922175 15:88356961-88356983 CCAAGCACTTGGGTAGATGGTAG No data
Right 1130922184 15:88356999-88357021 GGGGAAGGAGTTACCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130922184 Original CRISPR GGGGAAGGAGTTACCCCAGG AGG Intergenic
No off target data available for this crispr