ID: 1130923140

View in Genome Browser
Species Human (GRCh38)
Location 15:88365770-88365792
Sequence TCTGGGGTCCTGGACAGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130923140_1130923151 12 Left 1130923140 15:88365770-88365792 CCCCTTCTGTCCAGGACCCCAGA No data
Right 1130923151 15:88365805-88365827 GGTGACCTTGATAATGTGCTGGG No data
1130923140_1130923145 -9 Left 1130923140 15:88365770-88365792 CCCCTTCTGTCCAGGACCCCAGA No data
Right 1130923145 15:88365784-88365806 GACCCCAGATCATGGTGCCGAGG No data
1130923140_1130923153 23 Left 1130923140 15:88365770-88365792 CCCCTTCTGTCCAGGACCCCAGA No data
Right 1130923153 15:88365816-88365838 TAATGTGCTGGGTCTGACCCAGG No data
1130923140_1130923150 11 Left 1130923140 15:88365770-88365792 CCCCTTCTGTCCAGGACCCCAGA No data
Right 1130923150 15:88365804-88365826 AGGTGACCTTGATAATGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130923140 Original CRISPR TCTGGGGTCCTGGACAGAAG GGG (reversed) Intergenic
No off target data available for this crispr