ID: 1130927310

View in Genome Browser
Species Human (GRCh38)
Location 15:88395425-88395447
Sequence TTGACCCCATAGCAGCATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130927307_1130927310 4 Left 1130927307 15:88395398-88395420 CCGGGCTGGTTGTGGGGAGCGTG No data
Right 1130927310 15:88395425-88395447 TTGACCCCATAGCAGCATCTAGG No data
1130927302_1130927310 21 Left 1130927302 15:88395381-88395403 CCAGGGGGAGCAGGCAACCGGGC No data
Right 1130927310 15:88395425-88395447 TTGACCCCATAGCAGCATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130927310 Original CRISPR TTGACCCCATAGCAGCATCT AGG Intergenic
No off target data available for this crispr