ID: 1130927796

View in Genome Browser
Species Human (GRCh38)
Location 15:88398236-88398258
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130927796_1130927805 3 Left 1130927796 15:88398236-88398258 CCAATTTCTGGGCCTTTCCCCTG No data
Right 1130927805 15:88398262-88398284 GTTCTGCTCCCATGGGTCTGGGG No data
1130927796_1130927802 -4 Left 1130927796 15:88398236-88398258 CCAATTTCTGGGCCTTTCCCCTG No data
Right 1130927802 15:88398255-88398277 CCTGACAGTTCTGCTCCCATGGG No data
1130927796_1130927803 1 Left 1130927796 15:88398236-88398258 CCAATTTCTGGGCCTTTCCCCTG No data
Right 1130927803 15:88398260-88398282 CAGTTCTGCTCCCATGGGTCTGG No data
1130927796_1130927806 7 Left 1130927796 15:88398236-88398258 CCAATTTCTGGGCCTTTCCCCTG No data
Right 1130927806 15:88398266-88398288 TGCTCCCATGGGTCTGGGGTAGG No data
1130927796_1130927804 2 Left 1130927796 15:88398236-88398258 CCAATTTCTGGGCCTTTCCCCTG No data
Right 1130927804 15:88398261-88398283 AGTTCTGCTCCCATGGGTCTGGG No data
1130927796_1130927800 -5 Left 1130927796 15:88398236-88398258 CCAATTTCTGGGCCTTTCCCCTG No data
Right 1130927800 15:88398254-88398276 CCCTGACAGTTCTGCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130927796 Original CRISPR CAGGGGAAAGGCCCAGAAAT TGG (reversed) Intergenic