ID: 1130927798

View in Genome Browser
Species Human (GRCh38)
Location 15:88398253-88398275
Sequence CATGGGAGCAGAACTGTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130927798_1130927806 -10 Left 1130927798 15:88398253-88398275 CCCCTGACAGTTCTGCTCCCATG No data
Right 1130927806 15:88398266-88398288 TGCTCCCATGGGTCTGGGGTAGG No data
1130927798_1130927813 24 Left 1130927798 15:88398253-88398275 CCCCTGACAGTTCTGCTCCCATG No data
Right 1130927813 15:88398300-88398322 AGTATTTTTACAAGCCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130927798 Original CRISPR CATGGGAGCAGAACTGTCAG GGG (reversed) Intergenic