ID: 1130927800

View in Genome Browser
Species Human (GRCh38)
Location 15:88398254-88398276
Sequence CCCTGACAGTTCTGCTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130927796_1130927800 -5 Left 1130927796 15:88398236-88398258 CCAATTTCTGGGCCTTTCCCCTG No data
Right 1130927800 15:88398254-88398276 CCCTGACAGTTCTGCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130927800 Original CRISPR CCCTGACAGTTCTGCTCCCA TGG Intergenic