ID: 1130927801

View in Genome Browser
Species Human (GRCh38)
Location 15:88398255-88398277
Sequence CCCATGGGAGCAGAACTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130927801_1130927813 22 Left 1130927801 15:88398255-88398277 CCTGACAGTTCTGCTCCCATGGG No data
Right 1130927813 15:88398300-88398322 AGTATTTTTACAAGCCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130927801 Original CRISPR CCCATGGGAGCAGAACTGTC AGG (reversed) Intergenic