ID: 1130927803

View in Genome Browser
Species Human (GRCh38)
Location 15:88398260-88398282
Sequence CAGTTCTGCTCCCATGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130927796_1130927803 1 Left 1130927796 15:88398236-88398258 CCAATTTCTGGGCCTTTCCCCTG No data
Right 1130927803 15:88398260-88398282 CAGTTCTGCTCCCATGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130927803 Original CRISPR CAGTTCTGCTCCCATGGGTC TGG Intergenic