ID: 1130927804

View in Genome Browser
Species Human (GRCh38)
Location 15:88398261-88398283
Sequence AGTTCTGCTCCCATGGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130927796_1130927804 2 Left 1130927796 15:88398236-88398258 CCAATTTCTGGGCCTTTCCCCTG No data
Right 1130927804 15:88398261-88398283 AGTTCTGCTCCCATGGGTCTGGG No data
1130927797_1130927804 -10 Left 1130927797 15:88398248-88398270 CCTTTCCCCTGACAGTTCTGCTC No data
Right 1130927804 15:88398261-88398283 AGTTCTGCTCCCATGGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130927804 Original CRISPR AGTTCTGCTCCCATGGGTCT GGG Intergenic