ID: 1130927806

View in Genome Browser
Species Human (GRCh38)
Location 15:88398266-88398288
Sequence TGCTCCCATGGGTCTGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130927796_1130927806 7 Left 1130927796 15:88398236-88398258 CCAATTTCTGGGCCTTTCCCCTG No data
Right 1130927806 15:88398266-88398288 TGCTCCCATGGGTCTGGGGTAGG No data
1130927798_1130927806 -10 Left 1130927798 15:88398253-88398275 CCCCTGACAGTTCTGCTCCCATG No data
Right 1130927806 15:88398266-88398288 TGCTCCCATGGGTCTGGGGTAGG No data
1130927797_1130927806 -5 Left 1130927797 15:88398248-88398270 CCTTTCCCCTGACAGTTCTGCTC No data
Right 1130927806 15:88398266-88398288 TGCTCCCATGGGTCTGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130927806 Original CRISPR TGCTCCCATGGGTCTGGGGT AGG Intergenic
No off target data available for this crispr