ID: 1130927808

View in Genome Browser
Species Human (GRCh38)
Location 15:88398271-88398293
Sequence GGGGGCCTACCCCAGACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130927808_1130927814 17 Left 1130927808 15:88398271-88398293 CCATGGGTCTGGGGTAGGCCCCC No data
Right 1130927814 15:88398311-88398333 AAGCCACTCAGGAGATGCTGTGG No data
1130927808_1130927813 6 Left 1130927808 15:88398271-88398293 CCATGGGTCTGGGGTAGGCCCCC No data
Right 1130927813 15:88398300-88398322 AGTATTTTTACAAGCCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130927808 Original CRISPR GGGGGCCTACCCCAGACCCA TGG (reversed) Intergenic