ID: 1130927813

View in Genome Browser
Species Human (GRCh38)
Location 15:88398300-88398322
Sequence AGTATTTTTACAAGCCACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130927801_1130927813 22 Left 1130927801 15:88398255-88398277 CCTGACAGTTCTGCTCCCATGGG No data
Right 1130927813 15:88398300-88398322 AGTATTTTTACAAGCCACTCAGG No data
1130927799_1130927813 23 Left 1130927799 15:88398254-88398276 CCCTGACAGTTCTGCTCCCATGG No data
Right 1130927813 15:88398300-88398322 AGTATTTTTACAAGCCACTCAGG No data
1130927807_1130927813 7 Left 1130927807 15:88398270-88398292 CCCATGGGTCTGGGGTAGGCCCC No data
Right 1130927813 15:88398300-88398322 AGTATTTTTACAAGCCACTCAGG No data
1130927797_1130927813 29 Left 1130927797 15:88398248-88398270 CCTTTCCCCTGACAGTTCTGCTC No data
Right 1130927813 15:88398300-88398322 AGTATTTTTACAAGCCACTCAGG No data
1130927798_1130927813 24 Left 1130927798 15:88398253-88398275 CCCCTGACAGTTCTGCTCCCATG No data
Right 1130927813 15:88398300-88398322 AGTATTTTTACAAGCCACTCAGG No data
1130927808_1130927813 6 Left 1130927808 15:88398271-88398293 CCATGGGTCTGGGGTAGGCCCCC No data
Right 1130927813 15:88398300-88398322 AGTATTTTTACAAGCCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130927813 Original CRISPR AGTATTTTTACAAGCCACTC AGG Intergenic