ID: 1130928500

View in Genome Browser
Species Human (GRCh38)
Location 15:88403130-88403152
Sequence TTAATCATTCTGGCCAAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130928494_1130928500 30 Left 1130928494 15:88403077-88403099 CCACTAATTATTGCTACCCATTC No data
Right 1130928500 15:88403130-88403152 TTAATCATTCTGGCCAAGTTAGG No data
1130928497_1130928500 13 Left 1130928497 15:88403094-88403116 CCATTCTCAGGTCTCATCTTAAG No data
Right 1130928500 15:88403130-88403152 TTAATCATTCTGGCCAAGTTAGG No data
1130928496_1130928500 14 Left 1130928496 15:88403093-88403115 CCCATTCTCAGGTCTCATCTTAA No data
Right 1130928500 15:88403130-88403152 TTAATCATTCTGGCCAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130928500 Original CRISPR TTAATCATTCTGGCCAAGTT AGG Intergenic
No off target data available for this crispr