ID: 1130929678

View in Genome Browser
Species Human (GRCh38)
Location 15:88414718-88414740
Sequence GAGCAAAAACAGATGATACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130929674_1130929678 30 Left 1130929674 15:88414665-88414687 CCGTTTCTGCTTAAATTTGGCAA No data
Right 1130929678 15:88414718-88414740 GAGCAAAAACAGATGATACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130929678 Original CRISPR GAGCAAAAACAGATGATACA AGG Intergenic
No off target data available for this crispr