ID: 1130930907

View in Genome Browser
Species Human (GRCh38)
Location 15:88426975-88426997
Sequence TTACTCTTACCTAGGGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130930907_1130930911 4 Left 1130930907 15:88426975-88426997 CCCGCTTCCCTAGGTAAGAGTAA No data
Right 1130930911 15:88427002-88427024 ATCTGCTGAGCTGTGACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130930907 Original CRISPR TTACTCTTACCTAGGGAAGC GGG (reversed) Intergenic
No off target data available for this crispr