ID: 1130935170

View in Genome Browser
Species Human (GRCh38)
Location 15:88464060-88464082
Sequence ACCAAAAATATCTCTAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 8, 2: 40, 3: 94, 4: 307}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130935170_1130935182 21 Left 1130935170 15:88464060-88464082 CCATGTCTAGAGATATTTTTGGT 0: 1
1: 8
2: 40
3: 94
4: 307
Right 1130935182 15:88464104-88464126 AGGGGATGAGGTAGTGCTACTGG 0: 1
1: 0
2: 3
3: 18
4: 159
1130935170_1130935180 3 Left 1130935170 15:88464060-88464082 CCATGTCTAGAGATATTTTTGGT 0: 1
1: 8
2: 40
3: 94
4: 307
Right 1130935180 15:88464086-88464108 TGCACTGGGGGTGGGGTCAGGGG 0: 1
1: 0
2: 3
3: 91
4: 673
1130935170_1130935174 -9 Left 1130935170 15:88464060-88464082 CCATGTCTAGAGATATTTTTGGT 0: 1
1: 8
2: 40
3: 94
4: 307
Right 1130935174 15:88464074-88464096 ATTTTTGGTTACTGCACTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 167
1130935170_1130935181 9 Left 1130935170 15:88464060-88464082 CCATGTCTAGAGATATTTTTGGT 0: 1
1: 8
2: 40
3: 94
4: 307
Right 1130935181 15:88464092-88464114 GGGGGTGGGGTCAGGGGATGAGG 0: 1
1: 2
2: 32
3: 365
4: 3342
1130935170_1130935178 1 Left 1130935170 15:88464060-88464082 CCATGTCTAGAGATATTTTTGGT 0: 1
1: 8
2: 40
3: 94
4: 307
Right 1130935178 15:88464084-88464106 ACTGCACTGGGGGTGGGGTCAGG 0: 1
1: 0
2: 9
3: 51
4: 520
1130935170_1130935179 2 Left 1130935170 15:88464060-88464082 CCATGTCTAGAGATATTTTTGGT 0: 1
1: 8
2: 40
3: 94
4: 307
Right 1130935179 15:88464085-88464107 CTGCACTGGGGGTGGGGTCAGGG 0: 1
1: 0
2: 4
3: 62
4: 578
1130935170_1130935175 -6 Left 1130935170 15:88464060-88464082 CCATGTCTAGAGATATTTTTGGT 0: 1
1: 8
2: 40
3: 94
4: 307
Right 1130935175 15:88464077-88464099 TTTGGTTACTGCACTGGGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 130
1130935170_1130935176 -5 Left 1130935170 15:88464060-88464082 CCATGTCTAGAGATATTTTTGGT 0: 1
1: 8
2: 40
3: 94
4: 307
Right 1130935176 15:88464078-88464100 TTGGTTACTGCACTGGGGGTGGG 0: 1
1: 0
2: 2
3: 20
4: 159
1130935170_1130935173 -10 Left 1130935170 15:88464060-88464082 CCATGTCTAGAGATATTTTTGGT 0: 1
1: 8
2: 40
3: 94
4: 307
Right 1130935173 15:88464073-88464095 TATTTTTGGTTACTGCACTGGGG 0: 1
1: 0
2: 2
3: 14
4: 204
1130935170_1130935177 -4 Left 1130935170 15:88464060-88464082 CCATGTCTAGAGATATTTTTGGT 0: 1
1: 8
2: 40
3: 94
4: 307
Right 1130935177 15:88464079-88464101 TGGTTACTGCACTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 18
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130935170 Original CRISPR ACCAAAAATATCTCTAGACA TGG (reversed) Intronic
900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG + Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901096129 1:6681763-6681785 ACCAAGAGGGTCTCTAGACAGGG + Intronic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902176384 1:14653988-14654010 ACCAAAAATATCTCCAGGCCAGG + Intronic
902284797 1:15400547-15400569 ACTAAAATTATGTCCAGACATGG - Intergenic
904474335 1:30755207-30755229 ACCAAAAATGTCTCTAGTTATGG - Intronic
904592543 1:31622977-31622999 ACCAATAATATCTTTCCACAAGG + Intronic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
909212612 1:72843729-72843751 CACAAAAATATCTCTAAAAAAGG - Intergenic
909313150 1:74179611-74179633 AACAAAAATAACTCTTGAGAAGG - Intronic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911505985 1:98752118-98752140 ACCAAAAAAATCTCAAAACCTGG - Intronic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912017875 1:105064666-105064688 ACAAGAAGTATCTATAGACATGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
918199797 1:182256305-182256327 AAAAAAAATAACTCCAGACATGG - Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918833482 1:189429539-189429561 AACAAAAATATATCTTGAAAGGG - Intergenic
918900386 1:190408939-190408961 ACAAAAAATTTCTTTAGACAAGG - Intronic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921511310 1:216034082-216034104 AGGAAAAATATCTGAAGACAAGG + Intronic
924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG + Intronic
924178294 1:241415529-241415551 AGCAATAATGTATCTAGACATGG + Intergenic
924563568 1:245177387-245177409 CACAAAAATATCTCTAAATAGGG - Intronic
1065287016 10:24195956-24195978 AAAAAAAATTTCTGTAGACATGG - Intronic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1068474095 10:57503248-57503270 ACCAAAAATATTTCTGGATATGG + Intergenic
1071038478 10:81277325-81277347 GCTTAAAATATCTCTAAACATGG + Intergenic
1071954683 10:90744683-90744705 ACCAAAAATCCCTCCAGAAATGG + Intronic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1075170016 10:120104470-120104492 ACCAAAAATGTCTCTATCCCTGG - Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076161844 10:128250155-128250177 AAGAAAAATATCTCTACTCAGGG - Intergenic
1076232531 10:128833684-128833706 AGCAAAAACATCTCTAGGAAAGG + Intergenic
1076922686 10:133463180-133463202 ACCAAAGCTATCTCTGAACATGG + Intergenic
1077131137 11:973259-973281 ACCAAAAATGCCCCAAGACACGG - Intronic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1077619454 11:3707450-3707472 ACCAAAAAAAATTCTAGACTGGG + Intronic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1078974967 11:16463234-16463256 ACAAAAAATATATAAAGACAAGG - Intronic
1079813844 11:25029898-25029920 ACAAAATATATCTATTGACATGG - Intronic
1080050900 11:27857945-27857967 GCCATAAATATCTCGAGTCAGGG + Intergenic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082694244 11:56340486-56340508 ACTAAAAATTTGTCTAGTCAGGG - Intergenic
1082735292 11:56848286-56848308 AGCTAAAAAATGTCTAGACAGGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084660106 11:70541692-70541714 ACCAAAAATATCTCCCAACATGG - Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085196206 11:74673302-74673324 ACCAAAAATTCCTCTTGACCTGG - Intergenic
1085933603 11:81117245-81117267 ACCAAATAGATCTCAATACAAGG - Intergenic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1086568491 11:88255208-88255230 ACCAAAAAGAGCTCTGGACCAGG + Intergenic
1086991385 11:93307324-93307346 ACCAAAAAAATCCCTGGACCAGG + Intergenic
1087951935 11:104231698-104231720 ACCCAAATTATCTGTAGTCAAGG - Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1089897646 11:121947842-121947864 ACAAAAAAAATAACTAGACATGG - Intergenic
1090064600 11:123492011-123492033 ACCTACAATATCTCCAAACATGG - Intergenic
1090764789 11:129867102-129867124 ACCAAAAAGCTGACTAGACAGGG + Intronic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092812334 12:12283593-12283615 ACCTAAAATGTCTCTGGACTTGG - Intergenic
1093199434 12:16169329-16169351 AACAAACATATCTCAAGACATGG - Intergenic
1093261445 12:16942161-16942183 ATTACAAATATCTCTAAACATGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1094179308 12:27574574-27574596 ACCAAAAATAAGACTATACATGG - Intronic
1095046806 12:37516207-37516229 ACCACACATATATCTTGACAGGG + Intergenic
1096541432 12:52309527-52309549 ACTAAAAATGTCTCTAGATGTGG + Intergenic
1097349546 12:58533507-58533529 ACCAAAAATTTCACAAGTCAGGG - Intergenic
1097533363 12:60834439-60834461 TTCAAATATATCTCTAGAGAAGG - Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102624291 12:114222205-114222227 ACTAAGAATATCTCCACACATGG - Intergenic
1102862427 12:116348270-116348292 ACCATAAATTTCTCTTGAAAAGG - Intergenic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1107871143 13:44747853-44747875 AGCAAATATATCTCAAGAAAAGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108894152 13:55302149-55302171 AATAAAAATATTTCTAGGCAAGG + Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1110374954 13:74782822-74782844 ACAAAAAATATCTCTGGGCATGG - Intergenic
1110491060 13:76108554-76108576 ACCAAAATTATCTTTATACATGG - Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112364661 13:98746723-98746745 ACCAAAATTCCCTCTGGACATGG + Intronic
1112614596 13:100990380-100990402 ACCAAACATATCTCCAGATGTGG - Intergenic
1113282928 13:108809919-108809941 ACCATAAACATCTATAGAAAGGG + Intronic
1113719401 13:112542597-112542619 ACCAAATATACCTCTATAGATGG + Intronic
1114200984 14:20519652-20519674 AACAAAAATATTTTTAGAGATGG + Intergenic
1114295568 14:21326069-21326091 ATCAAAAACATGTATAGACAAGG - Exonic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1117625093 14:57628084-57628106 ACCAAAAATGTACGTAGACAAGG - Intronic
1117879705 14:60300992-60301014 ACAAAAAATATATTTAGAAAAGG - Intergenic
1119465847 14:74857722-74857744 ACAAAAAATATATATAGAGAGGG - Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1120250229 14:82054226-82054248 ACTAAAGATATGTCTAGAGAAGG - Intergenic
1120437486 14:84499014-84499036 ACCAACACAATCTCTAGAGAGGG + Intergenic
1123142674 14:106095919-106095941 ACCATAAAAATATCTAAACAGGG - Intergenic
1125045147 15:35236930-35236952 AACAAAAATATCTATCGACTAGG - Intronic
1125554373 15:40572077-40572099 TCCAAAAAAATCTTTAGAGATGG + Intronic
1126176766 15:45743183-45743205 ACCAAAAATATCCCTGGGAATGG - Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130748250 15:86680408-86680430 ACCCATAAAATCTCTAGGCAGGG - Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131091927 15:89629975-89629997 ACCAAAAGTATCTCCAGCCATGG + Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131597372 15:93812289-93812311 ACCAAAAATTTTTCTTGATATGG + Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133399790 16:5477222-5477244 ACCAAAAATATCTTCAGCCTGGG - Intergenic
1133579989 16:7135222-7135244 AACAAAAAAATTCCTAGACAGGG - Intronic
1133605362 16:7381923-7381945 CCCAAAGATGTCTCTAGACTTGG + Intronic
1133607873 16:7405908-7405930 ACTAAAAATGTCTCTGGACATGG - Intronic
1133661675 16:7924293-7924315 ACCACCACTATCTCCAGACATGG - Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134839422 16:17389876-17389898 ACTAAAAATACCTCAAGACCTGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135481633 16:22825617-22825639 ACCAAAAACATCTCTATCCAAGG - Intronic
1137392501 16:48093057-48093079 ACCCAATCTGTCTCTAGACATGG - Intronic
1138468093 16:57208692-57208714 ACAAAAAATATCTTTGGCCAGGG - Intronic
1138541583 16:57690882-57690904 AAAAAAAATATATCTAGGCATGG + Intergenic
1139255227 16:65534663-65534685 ACCAAGAATCTCTTCAGACAGGG + Intergenic
1139610482 16:68053410-68053432 ACCAAAAATAACTATGCACATGG - Intronic
1140248524 16:73273068-73273090 AAGAAAAATACCACTAGACAGGG + Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1142488947 17:265377-265399 ACAAAAAATATCTCTTGGCCAGG - Intronic
1143317837 17:6046080-6046102 AACCAAAATATCTCCAGGCATGG - Intronic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1145376267 17:22351824-22351846 ACCACACATATATCTTGACAGGG - Intergenic
1146040925 17:29453730-29453752 ACTCAAAATATAGCTAGACATGG - Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147011368 17:37451472-37451494 ACCAAAAATATAGCCAGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1148519438 17:48256795-48256817 ATAAAAAATATTTCTAGAAATGG + Intronic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1150421829 17:65043684-65043706 AACAAAAATATCTGTAGGCCAGG + Intronic
1150918104 17:69456791-69456813 ATGAAAAACATCTCTAGATAAGG - Intronic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151495250 17:74454633-74454655 ACCACAAATGTCTCTGGACACGG + Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1153990911 18:10399475-10399497 ACCAAAAACATCATTATACAGGG - Intergenic
1155378088 18:25184002-25184024 ACCAAAAATACATCAAAACAAGG + Intronic
1156111264 18:33730127-33730149 ACAAAAAACATCTCCAAACATGG - Intronic
1156411919 18:36838508-36838530 AGCAAAAATATCTTTTGAAAAGG - Intronic
1156839088 18:41590172-41590194 ACCAAAAATGTATATAGAGATGG + Intergenic
1157039208 18:44018318-44018340 ACCAAAAGAAGCCCTAGACAAGG + Intergenic
1157582473 18:48781568-48781590 AACAAAAATCTCGCTAGATATGG - Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159265962 18:66079464-66079486 AACAAAAATAAATTTAGACAAGG - Intergenic
1159309958 18:66694431-66694453 ACTAAAAAAATCTCCAGAAATGG - Intergenic
1161265787 19:3363752-3363774 ACCACAAATGTCCTTAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161462427 19:4406278-4406300 ACCAAAAATATCTCTATACGTGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1165681795 19:37783169-37783191 ACCACACATATATCTTGACAGGG + Intronic
1167925084 19:52814729-52814751 ACCAAAAAATTATCTGGACATGG + Intronic
1168243873 19:55100303-55100325 ACCAAAAATGTCTCTGGACGTGG - Intronic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
1168698332 19:58419054-58419076 ACAGAAAATACCTCTAGTCAAGG + Intergenic
925742093 2:7014957-7014979 ACCAAATAGATCACTAGACAAGG - Intronic
925960838 2:9013837-9013859 AAAAAGAATATCTCTAGAGAGGG - Intergenic
926215911 2:10905257-10905279 CCCAAAAATCTCTCTAGCCACGG + Intergenic
929252223 2:39771218-39771240 ACCATATATATCTCTAGAGAAGG + Intronic
929396332 2:41527319-41527341 AACAAAAATATGTATAGCCATGG + Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930434757 2:51326792-51326814 ACCAAAAATAAACCTAGTCATGG + Intergenic
931251527 2:60535426-60535448 GCCAAACCTATCTCTAAACATGG + Intronic
931750451 2:65325401-65325423 AGCAAAAATAGCACTATACAGGG + Intronic
933010564 2:77056832-77056854 ACCCTAAATATCTATAGGCAAGG + Intronic
935024059 2:99259485-99259507 AACAAATATATTCCTAGACATGG - Intronic
935817718 2:106862802-106862824 AGAAAAAACATTTCTAGACAGGG + Intronic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937330252 2:121022179-121022201 ACCAAAAATGTCTATGGACATGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937575457 2:123415540-123415562 AGCAAAAAAATCTCTGGCCATGG + Intergenic
938606650 2:132900403-132900425 AATAAAGATGTCTCTAGACATGG + Intronic
939679419 2:145111962-145111984 ACCAAAAATACCTGTATTCAAGG - Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
940630980 2:156238208-156238230 ACCAAAAAAATCTCTGGACCTGG + Intergenic
942742022 2:179192097-179192119 AACCAGAATGTCTCTAGACATGG + Intronic
942773823 2:179556560-179556582 GCCAAAATTATCTCCAGACAGGG + Intronic
946629974 2:221656532-221656554 ATCAAAAATATTTCTAGAGATGG - Intergenic
947157861 2:227181140-227181162 CCCAGAAATATCTCTATACCAGG - Intronic
947262892 2:228243571-228243593 ACCAAAAATATCTTTTCACGTGG - Intergenic
947287481 2:228532621-228532643 ACCAAAAAAATATCTAGAGAAGG + Intergenic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
1169566185 20:6855981-6856003 ACCAGAGAGATCTATAGACATGG + Intergenic
1169688886 20:8307983-8308005 ACAACAAATAGCTCTAGAAAAGG - Intronic
1169716225 20:8621622-8621644 GCCTAAAATATCGCTAAACAAGG + Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1170906369 20:20518356-20518378 AACAAAACTATCTCTGGTCAGGG - Intronic
1171799704 20:29600536-29600558 ACCACACATATATCTTGACAGGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175578322 20:60079309-60079331 ACCAGAAGCATCTCTTGACAAGG + Intergenic
1177151287 21:17457810-17457832 ACAAAAACTATTTATAGACATGG + Intergenic
1178286574 21:31330383-31330405 ACCAAAAACAACTCTGCACACGG - Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181974850 22:26721662-26721684 ACCAAAAACATCTCAAGACATGG - Intergenic
1182363397 22:29761285-29761307 AAAAAAAATAGCTGTAGACAGGG + Intronic
1182985301 22:34710631-34710653 GCCAAAATTAACACTAGACATGG + Intergenic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1183992543 22:41607640-41607662 ACCAAAAATATCTCTGGACATGG + Intronic
950828314 3:15848911-15848933 AGCAAAATTATCTCTAGTCACGG + Intronic
951072199 3:18343452-18343474 AGAAAAAAAATCTCTAAACAGGG - Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952252552 3:31668892-31668914 AAAAAAAAAATCTCTAGAGATGG - Intronic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953762212 3:45697751-45697773 ACCAAATATCTGTCAAGACAAGG - Intronic
954816023 3:53281335-53281357 ACCTAAAAGATCTCTTGAAATGG - Intergenic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956707787 3:72014178-72014200 AATAAAAATACCTCTAGATAGGG + Intergenic
956969103 3:74501314-74501336 TCAATAAATAACTCTAGACACGG + Intronic
958896950 3:99840004-99840026 GACAATAATATCTCCAGACATGG - Intronic
959975730 3:112456872-112456894 AACAATAATATCACTAGGCATGG + Intergenic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
963858348 3:150280005-150280027 AACAAAAGTATCTCTAGGCCAGG - Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964769955 3:160213860-160213882 AACAAAAACTTATCTAGACATGG - Intergenic
964880710 3:161419652-161419674 ACCACAACTATCTCCAGACATGG + Intergenic
965186354 3:165469481-165469503 CACAAACATATCTCTAAACAGGG + Intergenic
965455594 3:168896322-168896344 ACCAAAAAAATCTATATAAAAGG + Intergenic
965932215 3:174058859-174058881 ACAGAAATTATCTATAGACAAGG - Intronic
966355853 3:179078062-179078084 ACTAAAAATATGTCTTTACATGG - Intergenic
967042716 3:185708409-185708431 ACCAAAAACATCTCCAGGAAGGG + Intronic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
968796140 4:2706033-2706055 AAAAAAAATATCTGTAGAGATGG - Intronic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
970665873 4:18335547-18335569 AACAAAGTTATCTCTAGACCGGG + Intergenic
971095233 4:23393272-23393294 ACCAAAAATATCTCTGGCAGAGG + Intergenic
971258336 4:25033193-25033215 ACCCCAAATATCTCCACACATGG - Intergenic
971630378 4:28985350-28985372 ACGAAAAGCATCTCCAGACATGG - Intergenic
974639774 4:64613107-64613129 ACAAAGAATAAGTCTAGACAAGG + Intergenic
974784833 4:66606629-66606651 ACCAACAGTATCACTAGATATGG + Intergenic
975330684 4:73109001-73109023 ACCAAAAATTTATCTAGGCTGGG + Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
976752697 4:88466060-88466082 ACCAAAAACAACTCTTGACTTGG - Intronic
977377762 4:96228864-96228886 ATCAAAAACACCTCTAGAAATGG + Intergenic
977627967 4:99209089-99209111 TTCAAAAATATTTCTAGATATGG + Intronic
977937060 4:102818647-102818669 ACCAAAAAAATCTCTCTAAAAGG + Intronic
978300135 4:107258982-107259004 ACCAAAAAGATATATAGAAAAGG - Intronic
978346826 4:107779360-107779382 ACCACAATTAGCTCTAGAAATGG - Intergenic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
982659742 4:158192524-158192546 ACAAAAAATATTTCTAAACCTGG - Intergenic
983607512 4:169606647-169606669 ACCACAGATATCTCTAGATTGGG + Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
983762973 4:171437152-171437174 ACCTCATATATCTCTAGAAAAGG - Intergenic
983993029 4:174145227-174145249 ACTTTAAATATCTCTAAACAGGG - Intergenic
984294343 4:177834989-177835011 TCCAAAAATATCCCCAGAAAAGG - Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
984732607 4:183082406-183082428 AACAACAATATCTTTAGAAAGGG + Intergenic
985354145 4:189099055-189099077 AGCAGAAATATGTGTAGACAAGG - Intergenic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
986850994 5:11813561-11813583 ACCAAAAATATCTGTTGCTAAGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
987739988 5:21895260-21895282 ACAAATAATACCTCTAAACATGG - Intronic
989133917 5:38134648-38134670 ACCAAAAATATCAGCAGACATGG - Intergenic
989250018 5:39302307-39302329 ACCATAAATATATCAACACATGG - Intronic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
990972343 5:61522604-61522626 ATGGCAAATATCTCTAGACAAGG - Intronic
991023703 5:62007699-62007721 ACACAAAATGTCTCTGGACACGG + Intergenic
992577266 5:78127535-78127557 ACCAAAAATGTCCTTTGACAAGG - Intronic
992676844 5:79113092-79113114 ATCAAAAAGACCTCTACACAAGG + Intronic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993144966 5:84082208-84082230 ACCAATAATATTTCCACACATGG - Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995421019 5:111967006-111967028 AATAAAAATGTCTTTAGACATGG - Intronic
995434416 5:112119800-112119822 ACCACAAATCTCTCCAGAAAAGG + Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
1000971495 5:167719745-167719767 AACAAAAACATCACCAGACAGGG - Intronic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007118054 6:39357809-39357831 GCCAAAAACAAATCTAGACATGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009641699 6:66345711-66345733 ACCAGAAATGACTCTAGACATGG - Intergenic
1009859948 6:69314968-69314990 ACCAAAAATATATTTGGAAATGG + Intronic
1011843628 6:91533367-91533389 AGAAAAAATATCTGTAGTCAGGG - Intergenic
1012248565 6:96954707-96954729 AATAAAAGTATCTCTAGACTGGG - Intronic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG + Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014574144 6:123049579-123049601 AGTAAAAATAGCTCTATACATGG - Intronic
1015445733 6:133302246-133302268 ACCAAAGATTTCTCTAGCAATGG + Intronic
1017005028 6:150023481-150023503 GCCATAAATATCTCTGGAGAAGG - Intronic
1017869717 6:158476693-158476715 ACCAAACATGTCTATAGAAAAGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020612120 7:10411475-10411497 ACCAAAAATATCACTAGACGGGG + Intergenic
1020727578 7:11834517-11834539 AGCAAAGATATCTCTGAACAAGG + Intergenic
1021024925 7:15653933-15653955 AACAAGAATTTCTGTAGACATGG - Intronic
1021092286 7:16497592-16497614 TTCAAAATTATCTCTAAACAGGG - Intronic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022898281 7:34774849-34774871 ACCAAAAATATTCCTAGATGTGG + Intronic
1023528882 7:41133232-41133254 ACCAAGAATATCCAGAGACAAGG + Intergenic
1025037085 7:55601271-55601293 ACCAAAAAGAGCTCTGGACCAGG + Intergenic
1025292806 7:57746064-57746086 ACCAAACATATATCTTGACAGGG + Intergenic
1025298834 7:57799848-57799870 ACCACACATATATCTTGACAGGG - Intergenic
1026318931 7:69252178-69252200 AACAAAAATTTCTGTAGAGATGG + Intergenic
1026579216 7:71599983-71600005 AACCAAAATATCTTCAGACATGG + Intronic
1026732197 7:72921731-72921753 ACCATAAACAACTGTAGACATGG - Intronic
1027111770 7:75445616-75445638 ACCATAAACAACTGTAGACATGG + Intronic
1027284000 7:76630147-76630169 ACCATAAACAACTGTAGACATGG + Intergenic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1028654352 7:93186160-93186182 ACCAATAATTTCTCTGGGCATGG - Intergenic
1029062426 7:97811984-97812006 CACAAAAATACCTCTAGAGAAGG + Intergenic
1029460442 7:100691204-100691226 ACCCAGAATGTCTCTAGACTTGG - Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1030634553 7:111934042-111934064 AACAAAAATATCTATATTCAAGG + Intronic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032122124 7:129164392-129164414 AGCAAAAATAACAGTAGACAGGG - Intronic
1033004695 7:137548803-137548825 ACCAAAAATACATCTGGGCATGG + Intronic
1033563434 7:142556000-142556022 CCCAAGAATATATCTAGACCTGG + Intergenic
1036107807 8:5860399-5860421 TTCAAAAATATCTCTTGAGATGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036620335 8:10421112-10421134 ACCCAAAGGAGCTCTAGACATGG - Intronic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1036982438 8:13485048-13485070 ACAATAAAAATCCCTAGACAAGG + Intronic
1038131314 8:24734620-24734642 ACCAATAAAATTTCAAGACAAGG + Intergenic
1041479978 8:58309051-58309073 ACCACAGATATATCTAGAAATGG + Intergenic
1041742715 8:61174141-61174163 ACAAAAAATATCACTCAACATGG + Intronic
1042312747 8:67394981-67395003 AACAAACATCTCTCTAGCCAAGG - Intergenic
1043234736 8:77848954-77848976 ACCAAAACTAACTCAAAACAGGG - Intergenic
1043531519 8:81156513-81156535 AGAAAAAATATCTCTAGACATGG - Intergenic
1045328116 8:101132274-101132296 AGCTAGAACATCTCTAGACAAGG - Intergenic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1045909994 8:107396402-107396424 ACCAAAATTATCTTTAGAAATGG + Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046508420 8:115166112-115166134 AGCAAAATTATCTCTCAACAAGG + Intergenic
1046805402 8:118474254-118474276 AATAAAAATAGCTCTAGACTAGG - Intronic
1047043762 8:121028237-121028259 ACCAAAAATATCTGGAGATATGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048503370 8:134998766-134998788 ACCAAAAGTCTTTCCAGACAGGG - Intergenic
1048561901 8:135548186-135548208 ACCAAGCACTTCTCTAGACATGG + Intronic
1048807424 8:138253649-138253671 ACCAAACATGTCTCTGGGCATGG + Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050368023 9:4890435-4890457 ACCACAAAGAACTCTAGCCAGGG + Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1051460161 9:17303718-17303740 TCTAAAAATATGTGTAGACAAGG - Intronic
1051514816 9:17917648-17917670 ACCAAAGATATTTCAAGAAAAGG - Intergenic
1051752159 9:20353877-20353899 TCCAACAATATCTCTACAAAAGG + Intronic
1052269256 9:26609228-26609250 ACCATAAAAATCTCTATTCAGGG + Intergenic
1052344712 9:27397922-27397944 CCAAAAAGTGTCTCTAGACATGG + Intronic
1053252461 9:36586185-36586207 ACAAAAAATTTCGCTGGACATGG + Intronic
1053794763 9:41716183-41716205 ACCACACATATATCTTGACAGGG + Intergenic
1054150411 9:61598636-61598658 ACCACACATATATCTTGACAGGG - Intergenic
1054183174 9:61928242-61928264 ACCACACATATATCTTGACAGGG + Intergenic
1054470187 9:65529742-65529764 ACCACACATATATCTTGACAGGG - Intergenic
1054655333 9:67660232-67660254 ACCACACATATATCTTGACAGGG - Intergenic
1054937625 9:70705459-70705481 AACAAAATTATTTGTAGACATGG + Intronic
1054939316 9:70723452-70723474 AACAAAATTATTTGTAGACATGG + Intronic
1055357864 9:75455937-75455959 AACAGAAATACCTCTAGACTTGG - Intergenic
1055506267 9:76952630-76952652 ACCAAAAATGTTTCTAGAGTGGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1055844244 9:80542009-80542031 ATCAAAATTATAACTAGACAAGG - Intergenic
1057087098 9:92221237-92221259 ATCTAAAATATGTCTAAACAAGG + Intronic
1057547803 9:96031222-96031244 AACAGAAATATTTCCAGACAGGG + Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1060911342 9:127353738-127353760 ACCCAAGTTATCTCTAGGCAAGG - Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186614435 X:11171867-11171889 ACCAGAATTATCTCTAGACATGG + Intronic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187834411 X:23416614-23416636 ACCAACAATATCTCTCTACATGG + Intergenic
1188215449 X:27471021-27471043 ACCAAAAATATCTTCAGTCAGGG + Intergenic
1188761795 X:34041485-34041507 ACCAAAACTATTTCCAGATATGG - Intergenic
1188777372 X:34237107-34237129 ACTATAAATAACTTTAGACAAGG + Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1190149324 X:47930447-47930469 CCCAATAAAAACTCTAGACATGG - Intronic
1190363548 X:49671093-49671115 ACCAAAAATGTCTCTACGCTGGG + Intergenic
1190487105 X:50938709-50938731 ACCAAAAAATTATCCAGACATGG - Intergenic
1191589331 X:62863724-62863746 ACCAAAAATATTTAAAGAGAGGG - Intergenic
1191820030 X:65295923-65295945 AGCAAAAATATATCCAGAAAGGG + Intergenic
1193624920 X:83806578-83806600 AGCAAAAATCTCTTTTGACAAGG + Intergenic
1194613397 X:96071921-96071943 ATCAAAATTATCTCCAGAAAGGG - Intergenic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1197024718 X:121735040-121735062 AGTAAAAATATCTTTAGTCATGG - Intergenic
1197376987 X:125692393-125692415 ATTAAAATTATCTCTAGGCAAGG - Intergenic
1198330082 X:135614402-135614424 ACCACAAATATCTCCTGCCATGG + Intergenic
1198362754 X:135911868-135911890 ACCACAAATATCTCCTGCCATGG + Exonic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic