ID: 1130935255

View in Genome Browser
Species Human (GRCh38)
Location 15:88464732-88464754
Sequence GTTCCTCGAAGGGTCTCCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 76}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130935251_1130935255 7 Left 1130935251 15:88464702-88464724 CCTGAGAGTGTGGCCAGGGTTCG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1130935255 15:88464732-88464754 GTTCCTCGAAGGGTCTCCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 76
1130935252_1130935255 -6 Left 1130935252 15:88464715-88464737 CCAGGGTTCGTTCAGCTGTTCCT 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1130935255 15:88464732-88464754 GTTCCTCGAAGGGTCTCCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 76
1130935250_1130935255 10 Left 1130935250 15:88464699-88464721 CCACCTGAGAGTGTGGCCAGGGT 0: 1
1: 0
2: 0
3: 25
4: 219
Right 1130935255 15:88464732-88464754 GTTCCTCGAAGGGTCTCCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 76
1130935248_1130935255 11 Left 1130935248 15:88464698-88464720 CCCACCTGAGAGTGTGGCCAGGG 0: 1
1: 0
2: 3
3: 16
4: 194
Right 1130935255 15:88464732-88464754 GTTCCTCGAAGGGTCTCCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130935255 Original CRISPR GTTCCTCGAAGGGTCTCCCC AGG Exonic
902820439 1:18939958-18939980 TTTCCTCCAAGGGTCTCCAGAGG - Intronic
904940072 1:34159473-34159495 GTCCCTGGAAGCGTCTGCCCAGG - Intronic
911374531 1:97035547-97035569 ATTCCCTGAAGGTTCTCCCCGGG - Intergenic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
1074308751 10:112302801-112302823 CTTCCTCTAAGGGGCTTCCCTGG - Intronic
1074313307 10:112340989-112341011 GTTCCTCAAAGGCTGTCCTCTGG + Intergenic
1076177660 10:128380803-128380825 GGCCCTTGAAGGGACTCCCCAGG - Intergenic
1084486894 11:69453443-69453465 GTTCCCTGCAGGGTCTCCCGGGG - Intergenic
1085163023 11:74366554-74366576 CTTCCTTGAAGGATCTTCCCTGG - Intronic
1085522058 11:77144715-77144737 GTTCATCAAGGGGTCTGCCCAGG + Intronic
1105013144 12:132769258-132769280 GCTCCTCGAAGGGAGGCCCCAGG + Exonic
1107719091 13:43229381-43229403 GTACCTGGAATGGTCTCCCCCGG - Intronic
1113682522 13:112254297-112254319 GTTCCTCCTGGGGTCTCCCGTGG + Intergenic
1113820730 13:113210163-113210185 GTGCCTCGCAGGCTCTCGCCGGG + Intronic
1114661361 14:24347265-24347287 TTTCCTGGAAGGGTGACCCCAGG - Intergenic
1118743627 14:68758740-68758762 CCTCCTCAGAGGGTCTCCCCAGG + Intergenic
1121352771 14:93186411-93186433 GTTCCTTCAAGGGGCTCCTCAGG - Exonic
1122286412 14:100655162-100655184 GTTCCACGGAGGGGCTCCCTGGG + Intergenic
1122348321 14:101073780-101073802 GTTCGCCGAAGGGTCTCCCTGGG - Intergenic
1124014075 15:25861953-25861975 GTCCATCGCAGGGTCACCCCTGG + Intronic
1126218599 15:46185984-46186006 GTTCCTCTAAGGGTCACCAGAGG + Intergenic
1128880243 15:71236045-71236067 GTTCCTCGAGGGCAGTCCCCGGG + Intronic
1129257558 15:74342689-74342711 GTTCCACGTAGAGTCTCCACAGG - Intronic
1129788570 15:78325196-78325218 GTTCCTCGGTGTGTCTCTCCAGG - Intergenic
1130935255 15:88464732-88464754 GTTCCTCGAAGGGTCTCCCCAGG + Exonic
1132717804 16:1300951-1300973 GTCCCTGGAGGGGTCTCCACAGG + Intergenic
1134665384 16:16014854-16014876 GTTGCTCCAAGGGGCTCCCATGG + Intronic
1141866320 16:86752370-86752392 GTTCATTGAAGGGACTCCCACGG + Intergenic
1143162833 17:4882459-4882481 GTTTCTCTCAGGGTCTTCCCAGG + Intronic
1148214244 17:45825738-45825760 GATCCTCAAAGGGTGGCCCCTGG - Intronic
1151936744 17:77266546-77266568 GTTCCCCAAAGGGTGTCCCGTGG + Intergenic
1154329244 18:13415900-13415922 CATCCTGGAAGGCTCTCCCCTGG - Intronic
1161017546 19:1990804-1990826 GTTCATCGAAGAGTCGCGCCTGG + Exonic
1161303043 19:3552129-3552151 GTTCCATGCTGGGTCTCCCCAGG - Intronic
1162325369 19:9996108-9996130 CCTCCCCCAAGGGTCTCCCCGGG - Exonic
1164753500 19:30672869-30672891 GTTCCTCGGAGGGTCCCAGCAGG - Intronic
1166053425 19:40274686-40274708 GTTCCTCCCCAGGTCTCCCCCGG - Intronic
1167479353 19:49720015-49720037 ATTTCTCGAAGGGTCTCCGCGGG + Intergenic
1168112463 19:54201229-54201251 ATTTCTCGAAGGGTCTCCGCGGG - Exonic
926052015 2:9751391-9751413 GCTCCTGCAAGTGTCTCCCCTGG + Intergenic
927886461 2:26721570-26721592 GTTCCTCGTGGGCCCTCCCCTGG + Intronic
932822907 2:74916497-74916519 CTTCCTGGAATGCTCTCCCCAGG - Intergenic
935267977 2:101410814-101410836 ATAGCTCGAAGGGACTCCCCAGG + Intronic
938595740 2:132785421-132785443 GTTCCTTGCAGGGGCTCCCCAGG + Exonic
938804799 2:134796287-134796309 GGTGCTCAAAGGGTCTCACCAGG + Intergenic
940919056 2:159287207-159287229 GTTCCCCTAGGGGTCTCTCCCGG + Intergenic
947855847 2:233324011-233324033 CTACCTGGAAGGCTCTCCCCTGG - Intronic
1170571202 20:17633859-17633881 GTTTCTGGGAGGGGCTCCCCTGG - Intronic
1175257228 20:57654852-57654874 GGTCCTTGAGGGGTCTCCCAGGG + Intronic
1178840191 21:36132494-36132516 GTTTCTCGAAGGGTCTCTGCAGG - Intergenic
1179149584 21:38798530-38798552 CTCCCTAGAAGGGTCTTCCCAGG - Intergenic
1184284998 22:43465532-43465554 GGGCCTCGAAGGGGCTCCCAGGG + Intronic
950472485 3:13194648-13194670 CTACCTCGAGGGGTCTCCTCTGG - Intergenic
957841691 3:85679214-85679236 CTTTCTCGAAGAGTCTTCCCTGG - Intronic
960577475 3:119242608-119242630 GTTCCTAGACGGGTCGCCGCCGG - Intergenic
961883608 3:130080950-130080972 GTTCCTCGATGGATCTCTGCTGG - Intergenic
966851861 3:184169810-184169832 GTCCTGAGAAGGGTCTCCCCGGG + Intronic
969491101 4:7499688-7499710 TTTCCAGGAAGGGTCTCCCGGGG - Intronic
980230942 4:130045835-130045857 GTACCTCCCAGGGTCTCCTCAGG + Intergenic
982198071 4:152936095-152936117 GTGCCCCGAGGCGTCTCCCCCGG + Intergenic
993693408 5:91031222-91031244 GTTCCTTCAAGGGGCTCCTCAGG + Intronic
1000175098 5:158744255-158744277 GTTCCCCGTAGTGTCTGCCCTGG - Intronic
1001596270 5:172900909-172900931 GTTGCCCGAAGGGCCTCCGCAGG + Intronic
1004536713 6:16510212-16510234 GTTCCTCAAAGTGTCTTCCTGGG + Intronic
1006364686 6:33608445-33608467 GTCCCTGGAAGGGGGTCCCCAGG - Intergenic
1015767015 6:136729491-136729513 ATTGCTCAAAGGGTCTCCTCTGG - Intronic
1017842651 6:158233530-158233552 GGTCCTGGAAAGTTCTCCCCGGG + Intronic
1019369104 7:651648-651670 GTTCCGAGAGGGGTTTCCCCAGG - Intronic
1019369127 7:651750-651772 GTTCCGAGAGGGGTTTCCCCAGG - Intronic
1019369161 7:651903-651925 GTTCCGAGAGGGGTTTCCCCAGG - Intronic
1019369184 7:652005-652027 GTTCCGAGAGGGGTTTCCCCAGG - Intronic
1019369195 7:652056-652078 GTTCCGAGAGGGGTTTCCCCAGG - Intronic
1019369227 7:652209-652231 GTTCCGAGAGGGGTTTCCCCAGG - Intronic
1019369248 7:652311-652333 GTTCCGAGAGGGGTTTCCCCAGG - Intronic
1024519954 7:50296920-50296942 TCTCCTAGAAGGTTCTCCCCTGG - Intergenic
1025717574 7:63976399-63976421 GTACCTGGCAGGGTTTCCCCAGG - Intergenic
1030306728 7:108026502-108026524 GTTCTTCGACAGGTCTCACCTGG - Intronic
1031395072 7:121263784-121263806 GTCCCTCCTAGGGTATCCCCAGG - Intronic
1040392346 8:46961084-46961106 TTGCCTCTCAGGGTCTCCCCAGG - Intergenic
1046244582 8:111542434-111542456 ATTCCTAGAAGGGACTCCCCAGG - Intergenic
1048995343 8:139790555-139790577 GCTCCGCCAAGTGTCTCCCCAGG - Intronic
1062513715 9:136921737-136921759 GGTGCTCGTGGGGTCTCCCCTGG + Intronic
1187190302 X:17028156-17028178 GTTCCCCCATGTGTCTCCCCTGG + Intronic
1189247997 X:39578463-39578485 GTTCCTCTAGGGGTGGCCCCTGG + Intergenic
1200277883 X:154751237-154751259 GTTGCTCGAAGGGGCTTCCCAGG - Intronic