ID: 1130936222

View in Genome Browser
Species Human (GRCh38)
Location 15:88473005-88473027
Sequence AGGAGTGTATGAGGGGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130936215_1130936222 17 Left 1130936215 15:88472965-88472987 CCTTGAGAATAGTGTTTCCTGGT 0: 1
1: 0
2: 0
3: 14
4: 179
Right 1130936222 15:88473005-88473027 AGGAGTGTATGAGGGGCATATGG 0: 1
1: 0
2: 1
3: 17
4: 191
1130936217_1130936222 0 Left 1130936217 15:88472982-88473004 CCTGGTTTTGCTCAAGAGTTGGA 0: 1
1: 0
2: 3
3: 8
4: 125
Right 1130936222 15:88473005-88473027 AGGAGTGTATGAGGGGCATATGG 0: 1
1: 0
2: 1
3: 17
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130936222 Original CRISPR AGGAGTGTATGAGGGGCATA TGG Intronic
901262562 1:7884957-7884979 ATGCGTGGATGATGGGCATATGG - Intergenic
902441581 1:16433537-16433559 GGGTGTGTTTGAGGGGCGTAGGG - Intronic
903510960 1:23874643-23874665 AGAAGTGTGTGAGGGGCCTTGGG - Exonic
908561009 1:65306498-65306520 AGGTGTGTATGAAGGGGATGGGG + Intronic
910806186 1:91191651-91191673 AGGAGAAGATGAGGGGCTTAAGG - Intergenic
913008736 1:114661401-114661423 AGTTGTGTATCAGTGGCATAAGG - Intronic
914704467 1:150159688-150159710 AGGGGCATACGAGGGGCATATGG - Exonic
915017309 1:152746023-152746045 AGGAGTGTGTGGGGGGCAGGAGG - Intronic
915694896 1:157729904-157729926 AGGAGGGTAGGAGGGGTATAAGG + Intergenic
917100352 1:171439038-171439060 AGGAGTGGGTGAGGGGATTATGG - Intergenic
918366484 1:183813184-183813206 ATGAGTGTAGGCGGGGCACAGGG + Intronic
921024317 1:211262360-211262382 AGGATTAAATGATGGGCATATGG + Intronic
922533733 1:226364473-226364495 AGTAGTGTATAACGGGCAAATGG - Intronic
1069249946 10:66255555-66255577 AGGAGAGTGTGAGAGGCAAATGG - Intronic
1069555589 10:69395657-69395679 ATGTGTGTAAGAGGGCCATATGG + Intronic
1069659101 10:70111817-70111839 AGGAGAGTGTGAAGGGCAGAGGG - Exonic
1072438741 10:95436077-95436099 AGGAGTGACTGAAGGGCATCAGG - Intronic
1072466501 10:95667496-95667518 AGGAAGGGATGAGGGGCAGATGG + Intronic
1076066262 10:127450586-127450608 AGGTGTGTGTGATGGGCATGAGG + Intronic
1076246843 10:128953713-128953735 AGGAGTGGATGTGGGGCATATGG - Intergenic
1077219547 11:1409639-1409661 GGGGGTGTATGAAGGGCACAAGG + Intronic
1078062382 11:8056333-8056355 TTGAGTGTGTGAGGGCCATATGG + Intronic
1079682853 11:23320503-23320525 AGAATTCTATGAGGGGCATAAGG - Intergenic
1080784421 11:35461939-35461961 GAGAGGGTATGAAGGGCATAGGG - Intronic
1081292192 11:41340382-41340404 ATGAGAGTATATGGGGCATAAGG + Intronic
1081914032 11:46719525-46719547 GGCAGTGTAGGAGGGGCACAGGG + Intronic
1082169760 11:48989176-48989198 AGGAATGTATGAGGAGCTGAAGG - Intergenic
1083161746 11:60858692-60858714 AGGAATGAAGGAGGGGCAGATGG + Intergenic
1084131810 11:67141813-67141835 GGGTGTGTATGAGGGGCAAAGGG - Intronic
1084168235 11:67387069-67387091 TGGGGTGGATGAGGGGCATAGGG + Intronic
1085465814 11:76722521-76722543 AGGTGTGTATGCAGGGCACAGGG - Intergenic
1086696075 11:89847472-89847494 AGGAATGTATGAGGAGCTGAAGG + Intergenic
1086710081 11:89997017-89997039 AGGAATGTATGAGGAGCTGAAGG - Intergenic
1086931763 11:92701105-92701127 ATGAGTTTAAGAGGAGCATAAGG - Intronic
1089153740 11:116385011-116385033 AGGAGAGTATAAGGGGCAGGGGG + Intergenic
1089176547 11:116552684-116552706 AGCAGTGTTTGAGGGGCTTTAGG + Intergenic
1093318024 12:17675688-17675710 TTGAGTGAATGAGGGGAATATGG + Intergenic
1096276830 12:50216552-50216574 ATGAGTGAATGAGTGGTATATGG - Intronic
1096882593 12:54684903-54684925 AAGAGTGTATGAGGGGTGTGAGG + Intergenic
1096982415 12:55736119-55736141 AGGTGAGTGTGAGGGGCAGAAGG - Intergenic
1097146223 12:56941174-56941196 AGGAGTGTGTGGGGGACAGAGGG - Intergenic
1097151940 12:56985651-56985673 AGGAGTGTGTGGGGGACAGAGGG - Intergenic
1107178579 13:37429066-37429088 TGGAGTTTGTGAGGGGCATTGGG + Intergenic
1107285065 13:38781437-38781459 AGTAGTATATTAGGGACATATGG - Intronic
1107821312 13:44288376-44288398 AGGGGTATATGAGAGGCAAATGG + Intergenic
1109617742 13:64858728-64858750 AAGAGAGTATGAGTGGCATTAGG - Intergenic
1110311863 13:74058936-74058958 AGGAGATTAGGAGGGGAATAGGG - Intronic
1111302206 13:86361592-86361614 AGGAGAGTATATGGGGTATATGG - Intergenic
1113800271 13:113082843-113082865 AGGAGGGGATGAGGGGCAGGCGG - Intronic
1113991934 14:16034811-16034833 AGGAGGGTAAGAGGGGGACAAGG - Intergenic
1115522080 14:34243040-34243062 AGAAGTGCATGAGGGGAATAAGG - Intronic
1117558363 14:56909687-56909709 AGGAGTGTATTGGCTGCATAGGG + Intergenic
1117648901 14:57882029-57882051 AGGTCTGGATGAAGGGCATATGG - Intronic
1119131650 14:72178355-72178377 AGGACTGTCTGAGGGGGAAAGGG - Intronic
1122865209 14:104600828-104600850 AGGTCTGTTTGAGGGGCACATGG - Intronic
1124505068 15:30265238-30265260 AAGAGTGCATGAGGTGCATGAGG - Intergenic
1124738484 15:32273397-32273419 AAGAGTGCATGAGGTGCATGAGG + Intergenic
1124957003 15:34366526-34366548 GGGAGTGTAGGAAGGGCACAGGG + Intronic
1126269288 15:46794324-46794346 ATGTGTGTATCAGGGGTATAAGG + Intergenic
1127725882 15:61749428-61749450 AGGAGAGTCTGTGTGGCATATGG - Intergenic
1128522886 15:68387033-68387055 AGGAGGGGATGAGGGGGAAAGGG + Intronic
1129348856 15:74942272-74942294 AGGATTGTAAGAAGGGCCTATGG - Intergenic
1130936222 15:88473005-88473027 AGGAGTGTATGAGGGGCATATGG + Intronic
1133052472 16:3124891-3124913 TGGAGTGCCTGAGGGGCAGAGGG + Intergenic
1133157098 16:3882872-3882894 AGAAGTGTATCAGTGGCACAGGG + Intergenic
1137579265 16:49623321-49623343 AGGAGGGTGTGAGGGGCATTTGG - Intronic
1137915799 16:52428591-52428613 AGGAGGGTATGAGGTGGATAGGG - Intergenic
1142927890 17:3257129-3257151 AGGAGGGAAGGAGGGGCAGATGG - Intergenic
1143647331 17:8239207-8239229 AGGAATGCATGAGGGGCCTGAGG + Intronic
1146436269 17:32851484-32851506 AGGAGTAGATGAGGTGGATATGG - Intronic
1146643479 17:34559404-34559426 ATGAGTGTATGAATGGCATCTGG + Intergenic
1147047206 17:37762093-37762115 AGGAGTGTACAAGGGGGAAAGGG - Intergenic
1147466781 17:40616692-40616714 CGGAGTGCATGAGGGGGAGAGGG - Intergenic
1151077493 17:71290220-71290242 GGGAGTGTATGATGGGCATTGGG + Intergenic
1155103185 18:22634306-22634328 AGGAGACTTTGAGGGGCATCTGG - Intergenic
1157258944 18:46162264-46162286 AGGGGTATATAAGGTGCATACGG - Intergenic
1158270227 18:55705157-55705179 GGAAGTGTAATAGGGGCATAAGG - Intergenic
1159852394 18:73540087-73540109 AGAAGTTTAAGAGGGGCTTATGG - Intergenic
1161072970 19:2271441-2271463 AGGGGTGGGTGAGGGGCATCAGG - Exonic
1161588088 19:5116399-5116421 AGAAATGTGTGAGGGGAATAAGG + Intronic
1162249631 19:9431242-9431264 AGGACTGTGTTATGGGCATATGG - Intronic
1162377337 19:10312501-10312523 AGGAATGAATGAGGGGGATGGGG - Intronic
1162526875 19:11211317-11211339 AGGAGTGTAGGAGAGGCGGACGG - Intronic
1164662872 19:29993622-29993644 AAGATTGTATGAGGTGCATCAGG + Intronic
1164711361 19:30359348-30359370 TGGAGTGTATGAGGTGCAAATGG + Intronic
1165195587 19:34100285-34100307 AGGAATGTATGAATGGCATCTGG + Intergenic
1167642716 19:50690616-50690638 TGGAGTGTATTAGGGCCACATGG - Intronic
1168650406 19:58088769-58088791 TGGAGTGTACGAGAGGCACATGG - Exonic
925028859 2:633898-633920 AGCAGTGTCTGAGGGGTCTAAGG + Intergenic
927049804 2:19316177-19316199 AGGAGGGTGAGAGGGGCATGAGG - Intergenic
934583743 2:95469615-95469637 AGGAATGTATGAGGAGCTGAAGG - Intergenic
934595709 2:95607099-95607121 AGGAATGTATGAGGAGCTGAAGG + Intergenic
934787066 2:97018390-97018412 AGGAATGTATGAGGAGCTGAAGG - Intronic
935883584 2:107591793-107591815 AGGAGTCTCTAAGGGGCATTTGG + Intergenic
936093380 2:109514913-109514935 GGAAGTGTGTGAGGGGCATGGGG - Intergenic
938952680 2:136269874-136269896 AGCAGTGTATCAGTGGCATTGGG - Intergenic
939020367 2:136951092-136951114 AGGAGAGGATGAAGGGCATGAGG + Intronic
942049054 2:172121704-172121726 AGGAGTGTATGGATGGCATCTGG + Intergenic
942559939 2:177209803-177209825 AGGAGGGAATGAGGGTCCTAGGG - Intergenic
948770449 2:240248953-240248975 AGGTGAGTATGGGGGGCAGAGGG + Intergenic
1169058015 20:2639940-2639962 AGAAGTGAATGAGATGCATAAGG + Intronic
1169143353 20:3238208-3238230 AGGAGTATCTGAGGGACACATGG + Intronic
1170139476 20:13111400-13111422 AGTAGTGTGTGACTGGCATATGG + Intronic
1170600296 20:17836518-17836540 AGGAATCTAGGCGGGGCATAGGG - Intergenic
1171107154 20:22445441-22445463 AGGAGTTGAAGAGGGGCAAATGG + Intergenic
1171769920 20:29314427-29314449 AGGAGGGTAAGAGGGGGACAAGG + Intergenic
1174407139 20:50309936-50309958 GGGAGTGAGTGAGGGGCAGAGGG + Intergenic
1174491232 20:50897540-50897562 AGGAGTGTATGAATGGCATCTGG - Intronic
1175294894 20:57901629-57901651 AGCCTTGTGTGAGGGGCATAAGG + Intergenic
1176056069 20:63149972-63149994 AAGTGTGTAAGAGGGGCACAGGG + Intergenic
1180315338 22:11272715-11272737 AGGAGGGTAAGAGGGGGACAAGG + Intergenic
1181880719 22:25977625-25977647 TGGAGAGAATGAGGGGCACAGGG + Intronic
1183352926 22:37343886-37343908 AGGGGGGTGTGAGGGGCATCAGG - Intergenic
1184092358 22:42299356-42299378 AGGACTGTGTGAGAGGCAGATGG - Intronic
1184293473 22:43509951-43509973 AGGAATGGATGTGGGGCATGGGG + Intergenic
949231173 3:1752668-1752690 AGAATTTTACGAGGGGCATAAGG - Intergenic
949419786 3:3853529-3853551 TGGATTGTATGAGGAGCCTATGG + Intronic
950162237 3:10769122-10769144 AGGAATGTGTGATTGGCATAAGG + Intergenic
953041622 3:39260287-39260309 AGGAGTGAATAAGGGAAATATGG - Intergenic
953094532 3:39761915-39761937 AGGAGGGTAGAAGGGGCATATGG - Intergenic
953638232 3:44681157-44681179 ATGAGTGTATGAATGGCATCTGG - Intergenic
954967283 3:54622962-54622984 AGAAGGGGAGGAGGGGCATAGGG + Intronic
955349559 3:58183686-58183708 AGGAGGGTCTGAGGGTCCTAAGG + Intergenic
955703860 3:61708328-61708350 AGGAGTGTCTCAGGAGCATGAGG + Intronic
955737824 3:62058515-62058537 AGGTGTGTATGAGGGGGAGGGGG - Intronic
956693726 3:71901247-71901269 AGGAGTGCTTGAGGGGCAGAAGG - Intergenic
958894312 3:99813189-99813211 GGGAGTGTATGAAGGTCATGGGG + Intergenic
964044107 3:152300402-152300424 ATGATTGAATGAGGGGTATATGG + Intronic
967485971 3:190031347-190031369 AGAAGTGTATGCCGGGCATGAGG + Intronic
968847826 4:3056414-3056436 AGCAGTGTATGAGTGAAATATGG + Intergenic
968914764 4:3492567-3492589 AGGAGTGGATGAGGGGTAGAGGG + Intronic
971675799 4:29627760-29627782 AGGAGAGAATGAGGGGTAAAAGG - Intergenic
973203139 4:47528233-47528255 AGGAGGGTGGGAGGGGCATGAGG - Intronic
973266005 4:48211005-48211027 AGGAGTTTTTGAGGGGTAAATGG - Intronic
975589821 4:75988811-75988833 TGGAGTGGATGTGGGGGATAAGG - Intronic
975760887 4:77618698-77618720 AGGAGTGGATGAGGAACAGAAGG - Intergenic
978028804 4:103912488-103912510 AGGATTTCAGGAGGGGCATAGGG - Intergenic
981237995 4:142440628-142440650 AGGAGTGAATGACGGGCAGGGGG - Intronic
983366653 4:166799548-166799570 AGGAGTGTATAAATGGCATCAGG + Intronic
984149482 4:176108668-176108690 GGGAGGCTATGAGGGGTATATGG + Intronic
985198204 4:187455921-187455943 CAGAGTGTATGAGGGGCTGATGG + Intergenic
985319122 4:188689161-188689183 TGATGTGTATGGGGGGCATATGG + Intergenic
985477331 5:85533-85555 GGGAGTGTGTGTGGGGCAGAGGG + Intergenic
989570661 5:42943280-42943302 AGGAGGGAAGGAGGGACATAGGG + Intergenic
990458504 5:56012147-56012169 AGGATAGTATGAGGGCCAAATGG + Intergenic
992502462 5:77356153-77356175 AGAAGTGTATGAAGGGGAGAAGG - Intronic
992561188 5:77954425-77954447 AGAAGTGTATGGGGGGCAACGGG - Intergenic
993864440 5:93175471-93175493 AGGAGGGAATGAAGGCCATATGG - Intergenic
996308902 5:122080308-122080330 AGGAATGTATGGGGGGGATGGGG - Intergenic
1001293765 5:170484751-170484773 AGGAGGGTTTGAGAGGCAAAGGG - Intronic
1002311878 5:178319921-178319943 AGGAGTGACGGAGGGGCATGCGG - Intronic
1003276527 6:4658658-4658680 AGGAGTGTATGACTGGGAGAGGG + Intergenic
1004679005 6:17874203-17874225 AGGAGTGCAGGATGGGAATATGG - Intronic
1004859838 6:19792215-19792237 AGGAGTGGATGTGGGACATGGGG + Intergenic
1005703840 6:28430974-28430996 AGGAGTGTTTCAGTGGTATAGGG - Intergenic
1006214075 6:32423813-32423835 AGGAGTGTGTGAATGGCATCTGG + Intergenic
1011355814 6:86472484-86472506 ATGAATGACTGAGGGGCATAAGG - Intergenic
1014126719 6:117784504-117784526 AGGAAGGTATAAGGGGCAGAAGG - Intergenic
1015314437 6:131802453-131802475 GTAAGTGTAGGAGGGGCATATGG + Intergenic
1016928076 6:149373572-149373594 AGGAGTGAATGAATGCCATAGGG + Intronic
1021511616 7:21439479-21439501 AGGAGGGTGTGAGGGGAGTAGGG - Intronic
1022805767 7:33820813-33820835 AGGATTGTTAGAAGGGCATAAGG - Intergenic
1023654463 7:42405988-42406010 AGGAGTGTCTGGAGGGCATTGGG + Intergenic
1023863173 7:44227305-44227327 AGGAGAGTATGGGGGACAGAGGG + Intronic
1023863265 7:44227559-44227581 AGGAGGGTCTGGGGGGCAGAGGG + Intronic
1023973595 7:45010324-45010346 AGGACTTTCTAAGGGGCATAAGG - Intronic
1024817635 7:53289330-53289352 AGGTGGGTTTGAGGGGCAGAAGG - Intergenic
1024952936 7:54883654-54883676 AGGAGATTAAGAGGAGCATATGG - Intergenic
1026686921 7:72518934-72518956 GGGAATGGGTGAGGGGCATATGG - Intergenic
1027832357 7:83195463-83195485 AGGAGATTATGGGGGGCATCTGG - Intergenic
1030194058 7:106835888-106835910 AGGGATGTATTAGGGTCATAAGG - Intergenic
1031226582 7:119046451-119046473 AGGAGTGTATGAATGGCATCTGG - Intergenic
1031461580 7:122056758-122056780 AGGAGAGGATGAAGGGGATAGGG - Intronic
1034224188 7:149470132-149470154 AGGAGTGGATGAGGAGAACAAGG + Intergenic
1037187097 8:16077520-16077542 TAGAGTGTATGAGAAGCATAGGG + Intergenic
1037988367 8:23303523-23303545 AGGAGTGGATGAGAGGCCTGAGG + Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038040327 8:23718666-23718688 TGGAGTGAATGAGGGGAAGAGGG + Intergenic
1039923669 8:41910322-41910344 AGGCGTGTGTGATGGGCACAGGG - Intergenic
1041062555 8:54049821-54049843 AGGATTGTATGAAGTGGATAGGG - Intronic
1043229144 8:77777555-77777577 AGGATTGTTTGATGGGTATAGGG + Intergenic
1043306221 8:78800061-78800083 GGGAGAGTAGGAGGGGGATAAGG - Intronic
1046633071 8:116641109-116641131 AAGAGAGTAAGAGGGGCATGAGG - Intergenic
1047257887 8:123229573-123229595 CTGAGTGAGTGAGGGGCATAAGG + Intronic
1054145789 9:61559961-61559983 AGGAGTGCATGGGGAGCATTGGG - Intergenic
1054465533 9:65491065-65491087 AGGAGTGCATGGGGAGCATTGGG - Intergenic
1056256566 9:84805341-84805363 AGTAGTGTATGCGGGACAAAGGG - Intronic
1056328251 9:85500200-85500222 AGGAGTGAAGGAGGGGATTAAGG + Intergenic
1056828824 9:89897278-89897300 AGGAGTGTACAAGGGGCACCAGG - Intergenic
1057435125 9:95032905-95032927 AGGTGTGTATAATGGGGATAAGG + Intronic
1057994465 9:99808164-99808186 AGGAGTGGATGAAGGAGATAAGG + Intergenic
1058104827 9:100957723-100957745 AGGAGTTAAAGAGGGGCAGAAGG + Intergenic
1058712575 9:107693686-107693708 AGAAGTGTTTTAGGGGCACAGGG - Intergenic
1059710075 9:116859693-116859715 ATGAGTGTATGAAGGGGATGAGG + Intronic
1061480865 9:130897213-130897235 AGGAGTGTCTGTGGGGCAGAGGG - Intergenic
1061480903 9:130897346-130897368 AGGGGTGTGTGCGGGGCACAGGG - Intergenic
1062457653 9:136647018-136647040 AGGGGTGTTTGTGGGGCACATGG - Intergenic
1188200406 X:27288858-27288880 AGGAATGTATTAGGCTCATAAGG + Intergenic
1189802782 X:44707277-44707299 AGTGGTGTATGAGGGACATAAGG + Intergenic
1190311975 X:49123129-49123151 AGGAGTGTCTGAGGGGTCTGAGG - Intronic
1192578691 X:72263106-72263128 AGGAGACTGTGAGGTGCATAAGG - Intronic
1193739641 X:85202752-85202774 TGGAGGGTATGCGGGGCCTAAGG + Intergenic
1194656040 X:96575029-96575051 GGGGGTGGATGAGGGGCACAAGG - Intergenic
1195703844 X:107724343-107724365 AGGAGTGTTGGAAGGGCTTAAGG + Intronic
1195775227 X:108396290-108396312 AGGAGTGGAGGTGGGGGATACGG - Intronic
1198984325 X:142431861-142431883 AGGTGTGTATGGGGAGCATATGG - Intergenic
1200092816 X:153643770-153643792 AGGAGTGTGTGATCGGCAGAAGG + Intronic
1200257646 X:154593059-154593081 AGGAGAGGATGATGGGAATATGG - Intergenic
1201509684 Y:14745328-14745350 AGAAGTGTAGGATGGCCATATGG - Intronic
1201719246 Y:17078836-17078858 AAGAATGTATGTGGGGCACAAGG + Intergenic