ID: 1130938132

View in Genome Browser
Species Human (GRCh38)
Location 15:88487403-88487425
Sequence CTGCCTCTATTAGATTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130938132_1130938139 19 Left 1130938132 15:88487403-88487425 CCACAGGAATCTAATAGAGGCAG No data
Right 1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG No data
1130938132_1130938143 25 Left 1130938132 15:88487403-88487425 CCACAGGAATCTAATAGAGGCAG No data
Right 1130938143 15:88487451-88487473 GGATGGAGAGAAGTTGGGGGTGG No data
1130938132_1130938142 22 Left 1130938132 15:88487403-88487425 CCACAGGAATCTAATAGAGGCAG No data
Right 1130938142 15:88487448-88487470 TGGGGATGGAGAGAAGTTGGGGG No data
1130938132_1130938134 -10 Left 1130938132 15:88487403-88487425 CCACAGGAATCTAATAGAGGCAG No data
Right 1130938134 15:88487416-88487438 ATAGAGGCAGGAGAGAATGCTGG No data
1130938132_1130938137 4 Left 1130938132 15:88487403-88487425 CCACAGGAATCTAATAGAGGCAG No data
Right 1130938137 15:88487430-88487452 GAATGCTGGAGAAGTCAGTGGGG No data
1130938132_1130938140 20 Left 1130938132 15:88487403-88487425 CCACAGGAATCTAATAGAGGCAG No data
Right 1130938140 15:88487446-88487468 AGTGGGGATGGAGAGAAGTTGGG No data
1130938132_1130938136 3 Left 1130938132 15:88487403-88487425 CCACAGGAATCTAATAGAGGCAG No data
Right 1130938136 15:88487429-88487451 AGAATGCTGGAGAAGTCAGTGGG No data
1130938132_1130938141 21 Left 1130938132 15:88487403-88487425 CCACAGGAATCTAATAGAGGCAG No data
Right 1130938141 15:88487447-88487469 GTGGGGATGGAGAGAAGTTGGGG No data
1130938132_1130938144 28 Left 1130938132 15:88487403-88487425 CCACAGGAATCTAATAGAGGCAG No data
Right 1130938144 15:88487454-88487476 TGGAGAGAAGTTGGGGGTGGTGG No data
1130938132_1130938135 2 Left 1130938132 15:88487403-88487425 CCACAGGAATCTAATAGAGGCAG No data
Right 1130938135 15:88487428-88487450 GAGAATGCTGGAGAAGTCAGTGG No data
1130938132_1130938138 8 Left 1130938132 15:88487403-88487425 CCACAGGAATCTAATAGAGGCAG No data
Right 1130938138 15:88487434-88487456 GCTGGAGAAGTCAGTGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130938132 Original CRISPR CTGCCTCTATTAGATTCCTG TGG (reversed) Intergenic
No off target data available for this crispr