ID: 1130938139

View in Genome Browser
Species Human (GRCh38)
Location 15:88487445-88487467
Sequence CAGTGGGGATGGAGAGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130938132_1130938139 19 Left 1130938132 15:88487403-88487425 CCACAGGAATCTAATAGAGGCAG No data
Right 1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130938139 Original CRISPR CAGTGGGGATGGAGAGAAGT TGG Intergenic
No off target data available for this crispr