ID: 1130938879

View in Genome Browser
Species Human (GRCh38)
Location 15:88491461-88491483
Sequence TCTGCAGGCCCTTCACTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130938879_1130938887 0 Left 1130938879 15:88491461-88491483 CCAGGCAGTGAAGGGCCTGCAGA No data
Right 1130938887 15:88491484-88491506 GGAGGCTGGGGCGTGCCTAAGGG No data
1130938879_1130938889 12 Left 1130938879 15:88491461-88491483 CCAGGCAGTGAAGGGCCTGCAGA No data
Right 1130938889 15:88491496-88491518 GTGCCTAAGGGTCCCGAGCAGGG No data
1130938879_1130938893 25 Left 1130938879 15:88491461-88491483 CCAGGCAGTGAAGGGCCTGCAGA No data
Right 1130938893 15:88491509-88491531 CCGAGCAGGGCTGTGATCAGAGG No data
1130938879_1130938894 30 Left 1130938879 15:88491461-88491483 CCAGGCAGTGAAGGGCCTGCAGA No data
Right 1130938894 15:88491514-88491536 CAGGGCTGTGATCAGAGGCATGG No data
1130938879_1130938886 -1 Left 1130938879 15:88491461-88491483 CCAGGCAGTGAAGGGCCTGCAGA No data
Right 1130938886 15:88491483-88491505 AGGAGGCTGGGGCGTGCCTAAGG No data
1130938879_1130938888 11 Left 1130938879 15:88491461-88491483 CCAGGCAGTGAAGGGCCTGCAGA No data
Right 1130938888 15:88491495-88491517 CGTGCCTAAGGGTCCCGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130938879 Original CRISPR TCTGCAGGCCCTTCACTGCC TGG (reversed) Intergenic